Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

LEPREL2 cdna clone

LEPREL2 cDNA Clone

Gene Names
P3H3; GRCB; LEPREL2; HSU47926
Synonyms
LEPREL2; LEPREL2 cDNA Clone; LEPREL2 cdna clone
Ordering
For Research Use Only!
Sequence
atgcacctgcagatgcgggaggacatggctaagtacagacgaatgtcgggagttcggccccagagcttccgggacctggagacgcccccacactgggcagcctatgacactggcctggagctactggggcgccaggaggcaggactggcactgcccaggctagaggaggctcttcaggggagcctggcccagatggagagctgccgtgctgactgtgaggggcctgaggagcagcagggggctgaagaagaggaggatggggctgcgagccaggggggcctctatgaggccattgcaggacactggattcaggtcctgcagtgccggcaacgctgtgtgggggaaacagccacacgccctggtcgcagcttccctgtcccagacttccttcccaaccagctgaggcggctacatgaggcccatgctcaggtgggcaatctgtcccaggctatagaaaatgtcctgagtgtcctgctcttctacccggaggatgaggctgccaagagggctctgaaccagtaccaggcccagctgggagagccgagacctggcctcggacccagagaggacatccagcgcttcatcctccgatccctgggggagaagaggcagctctactatgccatggagcacctggggaccagcttcaaggatcctgacccctggacccctgcagctctcatccctgaggcacttagagaaaagctcagagaggatcaagagaagaggccttgggaccatgagcccgtgaagccaaagcccttgacctactggaaggatgtccttctcctggagggtgtgaccttgacccaggattccaggcagctgaatgggtcggagcgggcggtgttggatgggctgctcaccccagccgagtgtggggtgctgctgcagctggctaaggatgcagctggggctggagccaggtctggctatcgtggtcgccgctcccctcacaccccccatgaacgcttcgaggggctcacggtgcttaaggctgcgcagctggcccgggctgggacagtgggcagtcagggtgctaagctgcttctggaggtgagcgagcgggtgcggaccttgacccaggcctacttctccccggaacggcccctgcatctgtccttcacccacctggtgtgccgcagcgccatagaaggagagcaagagcagcgcatggacctgagtcacccagtgcacgcagacaactgcgtcctggaccctgacacgggagagtgctggcgggagcccccagcctacacctatcgggactacagcggactcctctacctcaacgatgacttccagggtggggacctgttcttcacggagcccaacgccctcactgtcacggctcgggtgcgtcctcgctgtgggcgccttgtggccttcagctccggtgtcgagaatccccatggggtgtgggccgtgactcggggacggcgctgtgccctggcactgtggcacacgtgggcacctgagcacagggagcaggagtggatagaagccaaagaactgctgcaggagtcacaggaggaggaggaagaggaagaggaagaaatgcccagcaaagacccttccccagagccccctagccgcaggcaccagagggtccaagacaagactggaagggcacctcgggttcgggaggagctgtga
Sequence Length
1656
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
62,295 Da
NCBI Official Full Name
Homo sapiens leprecan-like 2, mRNA
NCBI Official Synonym Full Names
prolyl 3-hydroxylase 3
NCBI Official Symbol
P3H3
NCBI Official Synonym Symbols
GRCB; LEPREL2; HSU47926
NCBI Protein Information
prolyl 3-hydroxylase 3
UniProt Protein Name
Prolyl 3-hydroxylase 3
UniProt Gene Name
P3H3
UniProt Entry Name
P3H3_HUMAN

NCBI Description

The protein encoded by this gene belongs to the leprecan family of proteoglycans, which function as collagen prolyl hydroxylases that are required for proper collagen biosynthesis, folding and assembly. This protein, like other family members, is thought to reside in the endoplasmic reticulum. Epigenetic inactivation of this gene is associated with breast and other cancers, suggesting that it may function as a tumor suppressor. [provided by RefSeq, Aug 2013]

Uniprot Description

LEPREL2: Has prolyl 3-hydroxylase activity catalyzing the post- translational formation of 3-hydroxyproline in -Xaa-Pro-Gly- sequences in collagens, especially types IV and V. Belongs to the leprecan family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Oxidoreductase; EC 1.14.11.7

Chromosomal Location of Human Ortholog: 12p13.31

Biological Process: negative regulation of cell proliferation

Research Articles on LEPREL2

Similar Products

Product Notes

The LEPREL2 p3h3 (Catalog #AAA1271129) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcacctgc agatgcggga ggacatggct aagtacagac gaatgtcggg agttcggccc cagagcttcc gggacctgga gacgccccca cactgggcag cctatgacac tggcctggag ctactggggc gccaggaggc aggactggca ctgcccaggc tagaggaggc tcttcagggg agcctggccc agatggagag ctgccgtgct gactgtgagg ggcctgagga gcagcagggg gctgaagaag aggaggatgg ggctgcgagc caggggggcc tctatgaggc cattgcagga cactggattc aggtcctgca gtgccggcaa cgctgtgtgg gggaaacagc cacacgccct ggtcgcagct tccctgtccc agacttcctt cccaaccagc tgaggcggct acatgaggcc catgctcagg tgggcaatct gtcccaggct atagaaaatg tcctgagtgt cctgctcttc tacccggagg atgaggctgc caagagggct ctgaaccagt accaggccca gctgggagag ccgagacctg gcctcggacc cagagaggac atccagcgct tcatcctccg atccctgggg gagaagaggc agctctacta tgccatggag cacctgggga ccagcttcaa ggatcctgac ccctggaccc ctgcagctct catccctgag gcacttagag aaaagctcag agaggatcaa gagaagaggc cttgggacca tgagcccgtg aagccaaagc ccttgaccta ctggaaggat gtccttctcc tggagggtgt gaccttgacc caggattcca ggcagctgaa tgggtcggag cgggcggtgt tggatgggct gctcacccca gccgagtgtg gggtgctgct gcagctggct aaggatgcag ctggggctgg agccaggtct ggctatcgtg gtcgccgctc ccctcacacc ccccatgaac gcttcgaggg gctcacggtg cttaaggctg cgcagctggc ccgggctggg acagtgggca gtcagggtgc taagctgctt ctggaggtga gcgagcgggt gcggaccttg acccaggcct acttctcccc ggaacggccc ctgcatctgt ccttcaccca cctggtgtgc cgcagcgcca tagaaggaga gcaagagcag cgcatggacc tgagtcaccc agtgcacgca gacaactgcg tcctggaccc tgacacggga gagtgctggc gggagccccc agcctacacc tatcgggact acagcggact cctctacctc aacgatgact tccagggtgg ggacctgttc ttcacggagc ccaacgccct cactgtcacg gctcgggtgc gtcctcgctg tgggcgcctt gtggccttca gctccggtgt cgagaatccc catggggtgt gggccgtgac tcggggacgg cgctgtgccc tggcactgtg gcacacgtgg gcacctgagc acagggagca ggagtggata gaagccaaag aactgctgca ggagtcacag gaggaggagg aagaggaaga ggaagaaatg cccagcaaag acccttcccc agagccccct agccgcaggc accagagggt ccaagacaag actggaaggg cacctcgggt tcgggaggag ctgtga. It is sometimes possible for the material contained within the vial of "LEPREL2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.