Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

LDHB cdna clone

LDHB cDNA Clone

Gene Names
LDHB; LDH-B; LDH-H; LDHBD; TRG-5; HEL-S-281
Synonyms
LDHB; LDHB cDNA Clone; LDHB cdna clone
Ordering
For Research Use Only!
Sequence
atggcaactcttaaggaaaaactcattgcaccagttgcggaagaagaggcaacagttccaaacaataagatcactgtagtgggtgttggacaagttggtatggcgtgtgctatcagcattctgggaaagtctctggctgatgaacttgctcttgtggatgttttggaagataagcttaaaggagaaatgatggatctgcagcatgggagcttatttcttcagacacctaaaattgtggcagataaagattattctgtgaccgccaattctaagattgtagtggtaactgcaggagtccgtcagcaagaaggggagagtcggctcaatctggtgcagagaaatgttaatgtcttcaaattcattattcctcagatcgtcaagtacagtcctgattgcatcataattgtggtttccaacccagtggacattcttacgtatgttacctggaaactaagtggattacccaaacaccgcgtgattggaagtggatgtaatctggattctgctagatttcgctaccttatggctgaaaaacttggcattcatcccagcagctgccatggatggattttgggggaacatggcgactcaagtgtggctgtgtggagtggtgtgaatgtggcaggtgtttctctccaggaattgaatccagaaatgggaactgacaatgatagtgaaaattggaaggaagtgcataagatggtggttgaaagtgcctatgaagtcatcaagctaaaaggatataccaactgggctattggattaagtgtggctgatcttattgaatccatgttgaaaaatctatccaggattcatcccgtgtcaacaatggtaaaggggatgtatggcattgagaatgaagtcttcctgagccttccatgtatcctcaatgcccggggattaaccagcgttatcaaccagaagctaaaggatgatgaggttgctcagctcaagaaaagtgcagataccctgtgggacatccagaaggacctaaaagacctgtga
Sequence Length
1005
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
36,638 Da
NCBI Official Full Name
Homo sapiens lactate dehydrogenase B, mRNA
NCBI Official Synonym Full Names
lactate dehydrogenase B
NCBI Official Symbol
LDHB
NCBI Official Synonym Symbols
LDH-B; LDH-H; LDHBD; TRG-5; HEL-S-281
NCBI Protein Information
L-lactate dehydrogenase B chain
UniProt Protein Name
L-lactate dehydrogenase B chain
Protein Family
UniProt Gene Name
LDHB
UniProt Synonym Gene Names
LDH-B; LDH-H
UniProt Entry Name
LDHB_HUMAN

NCBI Description

This gene encodes the B subunit of lactate dehydrogenase enzyme, which catalyzes the interconversion of pyruvate and lactate with concomitant interconversion of NADH and NAD+ in a post-glycolysis process. Alternatively spliced transcript variants have been found for this gene. Recent studies have shown that a C-terminally extended isoform is produced by use of an alternative in-frame translation termination codon via a stop codon readthrough mechanism, and that this isoform is localized in the peroxisomes. Mutations in this gene are associated with lactate dehydrogenase B deficiency. Pseudogenes have been identified on chromosomes X, 5 and 13. [provided by RefSeq, Feb 2016]

Research Articles on LDHB

Similar Products

Product Notes

The LDHB ldhb (Catalog #AAA1278325) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcaactc ttaaggaaaa actcattgca ccagttgcgg aagaagaggc aacagttcca aacaataaga tcactgtagt gggtgttgga caagttggta tggcgtgtgc tatcagcatt ctgggaaagt ctctggctga tgaacttgct cttgtggatg ttttggaaga taagcttaaa ggagaaatga tggatctgca gcatgggagc ttatttcttc agacacctaa aattgtggca gataaagatt attctgtgac cgccaattct aagattgtag tggtaactgc aggagtccgt cagcaagaag gggagagtcg gctcaatctg gtgcagagaa atgttaatgt cttcaaattc attattcctc agatcgtcaa gtacagtcct gattgcatca taattgtggt ttccaaccca gtggacattc ttacgtatgt tacctggaaa ctaagtggat tacccaaaca ccgcgtgatt ggaagtggat gtaatctgga ttctgctaga tttcgctacc ttatggctga aaaacttggc attcatccca gcagctgcca tggatggatt ttgggggaac atggcgactc aagtgtggct gtgtggagtg gtgtgaatgt ggcaggtgtt tctctccagg aattgaatcc agaaatggga actgacaatg atagtgaaaa ttggaaggaa gtgcataaga tggtggttga aagtgcctat gaagtcatca agctaaaagg atataccaac tgggctattg gattaagtgt ggctgatctt attgaatcca tgttgaaaaa tctatccagg attcatcccg tgtcaacaat ggtaaagggg atgtatggca ttgagaatga agtcttcctg agccttccat gtatcctcaa tgcccgggga ttaaccagcg ttatcaacca gaagctaaag gatgatgagg ttgctcagct caagaaaagt gcagataccc tgtgggacat ccagaaggac ctaaaagacc tgtga. It is sometimes possible for the material contained within the vial of "LDHB, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.