Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

LCK cdna clone

LCK cDNA Clone

Gene Names
LCK; LSK; YT16; IMD22; p56lck; pp58lck
Synonyms
LCK; LCK cDNA Clone; LCK cdna clone
Ordering
For Research Use Only!
Sequence
atgggctgtggctgcagctcacacccggaagatgactggatggaaaacatcgatgtgtgtgagaactgccattatcccatagtcccactggatggcaagggcacgctgctcatccgaaatggctctgaggtgcgggacccactggttacctacgaaggctccaatccgccggcttccccactgcaagacaacctggttatcgctctgcacagctatgagccctctcacgacggagatctgggctttgagaagggggaacagctccgcatcctggagcagagcggcgagtggtggaaggcgcagtccctgaccacgggccaggaaggcttcatccccttcaattttgtggccaaagcgaacagcctggagcccgaaccctggttcttcaagaacctgagccgcaaggacgcggagcggcagctcctggcgcccgggaacactcacggctccttcctcatccgggagagcgagagcaccgcgggatcgttttcactgtcggtccgggacttcgaccagaaccagggagaggtggtgaaacattacaagatccgtaatctggacaacggtggcttctacatctcccctcgaatcacttttcccggcctgcatgaactggtccgccattacaccaatgcttcagatgggctgtgcacacggttgagccgcccctgccagacccagaagccccagaagccgtggtgggaggacgagtgggaggttcccagggagacgctgaagctggtggagcggctgggggctggacagttcggggaggtgtggatggggtactacaacgggcacacgaaggtggcggtgaagagcctgaagcagggcagcatgtccccggacgccttcctggccgaggccaacctcatgaagcagctgcaacaccagcggctggttcggctctacgctgtggtcacccaggagcccatctacatcatcactgaatacatggagaatgacacacttctagactcccagttggaggagaaaggtctgggggcctccccctggggcaacttgggccagcaactcttgcttctgcccacagggagtctagtggattttctcaagaccccttcaggcatcaagttgaccatcaacaaactcctggacatggcagcccaaattgcagaaggcatggcattcattgaagagcggaattatattcatcgtgaccttcgggctgccaacattctggtgtctgacaccctgagctgcaagattgcagactttggcctagcacgcctcattgaggacaacgagtacacagccagggagggggccaagtttcccattaagtggacagcgccagaagccattaactacgggacattcaccatcaagtcagatgtgtggtcttttgggatcctgctgacggaaattgtcacccacggccgcatcccttacccagggatgaccaacccggaggtgattcagaacctggagcgaggctaccgcatggtgcgccctgacaactgtccagaggagctgtaccaactcatgaggctgtgctggaaggagcgcccagaggaccggcccacctttgactacctgcgcagtgtgctggaggacttcttcacggccacagagggccagtaccagcctcagccttga
Sequence Length
1620
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
61,190 Da
NCBI Official Full Name
Homo sapiens lymphocyte-specific protein tyrosine kinase, mRNA
NCBI Official Synonym Full Names
LCK proto-oncogene, Src family tyrosine kinase
NCBI Official Symbol
LCK
NCBI Official Synonym Symbols
LSK; YT16; IMD22; p56lck; pp58lck
NCBI Protein Information
tyrosine-protein kinase Lck
UniProt Protein Name
Tyrosine-protein kinase Lck
UniProt Gene Name
LCK
UniProt Synonym Gene Names
LSK
UniProt Entry Name
LCK_HUMAN

NCBI Description

This gene is a member of the Src family of protein tyrosine kinases (PTKs). The encoded protein is a key signaling molecule in the selection and maturation of developing T-cells. It contains N-terminal sites for myristylation and palmitylation, a PTK domain, and SH2 and SH3 domains which are involved in mediating protein-protein interactions with phosphotyrosine-containing and proline-rich motifs, respectively. The protein localizes to the plasma membrane and pericentrosomal vesicles, and binds to cell surface receptors, including CD4 and CD8, and other signaling molecules. Multiple alternatively spliced variants encoding different isoforms have been described. [provided by RefSeq, Aug 2016]

Uniprot Description

Lck: a tyrosine kinase of the Src family that is crucial to antigen-receptor signaling in lymphocytes. plays an essential role for the selection and maturation of developing T-cell in the thymus and in mature T-cell function. Is constitutively associated with the cytoplasmic portions of the CD4 and CD8 surface receptors and plays a key role in T-cell antigen receptor(TCR)-linked signal transduction pathways. Association of the TCR with a peptide antigen-bound MHC complex facilitates the interaction of CD4 and CD8 with MHC class II and class I molecules, respectively, and thereby recruits the associated LCK to the vicinity of the TCR/CD3 complex. LCK then phosphorylates tyrosines residues within the immunoreceptor tyrosines-based activation motifs (ITAMs) in the cytoplasmic tails of the TCRgamma chains and CD3 subunits, initiating the TCR/CD3 signaling pathway. In addition, contributes to signaling by other receptor molecules. Associates directly with the cytoplasmic tail of CD2, and upon engagement of the CD2 molecule, LCK undergoes hyperphosphorylation and activation. Also plays a role in the IL2 receptor-linked signaling pathway that controls T-cell proliferative response. Binding of IL2 to its receptor results in increased activity of LCK. Is expressed at all stages of thymocyte development and is required for the regulation of maturation events that are governed by both pre-TCR and mature alpha beta TCR. Binds to the cytoplasmic domain of cell surface receptors, such as CD2, CD4, CD5, CD8, CD44, CD45 and CD122. Also binds to effector molecules, such as PI4K, VAV1, RASA1, FYB and to other protein kinases including CDC2, RAF1, ZAP70 and SYK. Binds to phosphatidylinositol 3'-kinase (PI3K) from T-lymphocytes through its SH3 domain and to the tyrosine phosphorylated form of Sam68 through its SH2 domain. Binds to HIV-1 Nef through its SH3 domain. This interaction inhibits its tyrosine-kinase activity. Overexpression in mice leads to thymic tumors. Aberrant expression is seen in T cell leukemias and colon cancer. The leukemic translocation t(1;7)(p34;q34) has breakpoints at the T cell receptor gene and close to the Lck promoters, can cause increased Lck expression, and in one case, point mutations. A mutated Lck has also been seen in a cell line. One patient with aberrant Lck splicing suffered from SCID-like T cell deficiency. Inhibitor: BMS-279700. Three alternatively spliced isoforms of the human proteinhave been described.

Protein type: Oncoprotein; Protein kinase, TK; Protein kinase, tyrosine (non-receptor); EC 2.7.10.2; Kinase, protein; TK group; Src family

Chromosomal Location of Human Ortholog: 1p34.3

Cellular Component: cytosol; extrinsic to internal side of plasma membrane; immunological synapse; lipid raft; pericentriolar material; plasma membrane

Molecular Function: ATPase binding; CD4 receptor binding; CD8 receptor binding; glycoprotein binding; identical protein binding; kinase activity; non-membrane spanning protein tyrosine kinase activity; phosphatidylinositol-4,5-bisphosphate 3-kinase activity; phosphoinositide 3-kinase binding; protein binding; protein C-terminus binding; protein kinase binding; protein phosphatase binding; protein serine/threonine phosphatase activity; protein-tyrosine kinase activity; SH2 domain binding

Biological Process: B cell receptor signaling pathway; caspase activation; cellular zinc ion homeostasis; innate immune response; leukocyte migration; phosphoinositide-mediated signaling; platelet activation; positive regulation of T cell activation; protein amino acid phosphorylation; regulation of cell proliferation; regulation of defense response to virus by virus; regulation of phosphoinositide 3-kinase cascade; release of sequestered calcium ion into cytosol; response to drug; T cell costimulation; T cell differentiation; T cell receptor signaling pathway; transmembrane receptor protein tyrosine kinase signaling pathway

Disease: Immunodeficiency 22

Research Articles on LCK

Similar Products

Product Notes

The LCK lck (Catalog #AAA1272466) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggctgtg gctgcagctc acacccggaa gatgactgga tggaaaacat cgatgtgtgt gagaactgcc attatcccat agtcccactg gatggcaagg gcacgctgct catccgaaat ggctctgagg tgcgggaccc actggttacc tacgaaggct ccaatccgcc ggcttcccca ctgcaagaca acctggttat cgctctgcac agctatgagc cctctcacga cggagatctg ggctttgaga agggggaaca gctccgcatc ctggagcaga gcggcgagtg gtggaaggcg cagtccctga ccacgggcca ggaaggcttc atccccttca attttgtggc caaagcgaac agcctggagc ccgaaccctg gttcttcaag aacctgagcc gcaaggacgc ggagcggcag ctcctggcgc ccgggaacac tcacggctcc ttcctcatcc gggagagcga gagcaccgcg ggatcgtttt cactgtcggt ccgggacttc gaccagaacc agggagaggt ggtgaaacat tacaagatcc gtaatctgga caacggtggc ttctacatct cccctcgaat cacttttccc ggcctgcatg aactggtccg ccattacacc aatgcttcag atgggctgtg cacacggttg agccgcccct gccagaccca gaagccccag aagccgtggt gggaggacga gtgggaggtt cccagggaga cgctgaagct ggtggagcgg ctgggggctg gacagttcgg ggaggtgtgg atggggtact acaacgggca cacgaaggtg gcggtgaaga gcctgaagca gggcagcatg tccccggacg ccttcctggc cgaggccaac ctcatgaagc agctgcaaca ccagcggctg gttcggctct acgctgtggt cacccaggag cccatctaca tcatcactga atacatggag aatgacacac ttctagactc ccagttggag gagaaaggtc tgggggcctc cccctggggc aacttgggcc agcaactctt gcttctgccc acagggagtc tagtggattt tctcaagacc ccttcaggca tcaagttgac catcaacaaa ctcctggaca tggcagccca aattgcagaa ggcatggcat tcattgaaga gcggaattat attcatcgtg accttcgggc tgccaacatt ctggtgtctg acaccctgag ctgcaagatt gcagactttg gcctagcacg cctcattgag gacaacgagt acacagccag ggagggggcc aagtttccca ttaagtggac agcgccagaa gccattaact acgggacatt caccatcaag tcagatgtgt ggtcttttgg gatcctgctg acggaaattg tcacccacgg ccgcatccct tacccaggga tgaccaaccc ggaggtgatt cagaacctgg agcgaggcta ccgcatggtg cgccctgaca actgtccaga ggagctgtac caactcatga ggctgtgctg gaaggagcgc ccagaggacc ggcccacctt tgactacctg cgcagtgtgc tggaggactt cttcacggcc acagagggcc agtaccagcc tcagccttga. It is sometimes possible for the material contained within the vial of "LCK, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.