Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

LAT2 cdna clone

LAT2 cDNA Clone

Gene Names
LAT2; LAB; NTAL; WSCR5; WBSCR5; HSPC046; WBSCR15
Synonyms
LAT2; LAT2 cDNA Clone; LAT2 cdna clone
Ordering
For Research Use Only!
Sequence
atgagctcggggactgaactgctgtggcccggagcagcgctgctggtgctgttgggggtggcagccagtctgtgtgtgcgctgctcacgcccaggtgcaaagaggtcagagaaaatctaccagcagagaagtctgcgtgaggaccaacagagctttacggggtcccggacctactccttggtcgggcaggcatggccaggacccctggcggacatggcacccacaaggaaggacaagctgttgcaattctaccccagcctggaggatccagcatcttccaggtaccagaacttcagcaaaggaagcagacacgggtcggaggaagcctacatagaccccattgccatggagtattacaactgggggcggttctcgaagcccccagaagatgatgatgccaattcctacgagaatgtgctcatttgcaagcagaaaaccacagagacaggtgcccagcaggagggcataggtggcctctgcagaggggacctcagcctgtcactggccctgaagactggccccacttctggtctctgtccctctgcctccccggaagaagatgaggaatctgaggattatcagaactcagcatccatccatcagtggcgcgagtccaggaaggtcatggggcaactccagagagaagcatcccctggcccggtgggaagcccagacgaggaggacggggaaccggattacgtgaatggggaggtggcagccacagaagcctag
Sequence Length
732
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
12,255 Da
NCBI Official Full Name
Homo sapiens linker for activation of T cells family, member 2, mRNA
NCBI Official Synonym Full Names
linker for activation of T-cells family member 2
NCBI Official Symbol
LAT2
NCBI Official Synonym Symbols
LAB; NTAL; WSCR5; WBSCR5; HSPC046; WBSCR15
NCBI Protein Information
linker for activation of T-cells family member 2
UniProt Protein Name
Linker for activation of T-cells family member 2
UniProt Gene Name
LAT2
UniProt Synonym Gene Names
LAB; NTAL; WBS15; WBSCR15; WBSCR5
UniProt Entry Name
NTAL_HUMAN

NCBI Description

This gene is one of the contiguous genes at 7q11.23 commonly deleted in Williams syndrome, a multisystem developmental disorder. This gene consists of at least 14 exons, and its alternative splicing generates 3 transcript variants, all encoding the same protein. [provided by RefSeq, Jul 2008]

Uniprot Description

LAB: linker for activation of B cells (LAB) is an adaptor protein. B cell antigen receptor signaling leads to its phosphorylation and interaction with the adaptor protein Grb2. Decreased expression leads to a reduction in BCR-mediated calcium flux and Erk activation. Localized to lipid rafts.

Protein type: Adaptor/scaffold; Membrane protein, integral

Chromosomal Location of Human Ortholog: 7q11.23

Cellular Component: lipid raft; plasma membrane

Molecular Function: protein binding; SH2 domain binding

Biological Process: B cell activation; B cell receptor signaling pathway; calcium-mediated signaling

Research Articles on LAT2

Similar Products

Product Notes

The LAT2 lat2 (Catalog #AAA1277019) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagctcgg ggactgaact gctgtggccc ggagcagcgc tgctggtgct gttgggggtg gcagccagtc tgtgtgtgcg ctgctcacgc ccaggtgcaa agaggtcaga gaaaatctac cagcagagaa gtctgcgtga ggaccaacag agctttacgg ggtcccggac ctactccttg gtcgggcagg catggccagg acccctggcg gacatggcac ccacaaggaa ggacaagctg ttgcaattct accccagcct ggaggatcca gcatcttcca ggtaccagaa cttcagcaaa ggaagcagac acgggtcgga ggaagcctac atagacccca ttgccatgga gtattacaac tgggggcggt tctcgaagcc cccagaagat gatgatgcca attcctacga gaatgtgctc atttgcaagc agaaaaccac agagacaggt gcccagcagg agggcatagg tggcctctgc agaggggacc tcagcctgtc actggccctg aagactggcc ccacttctgg tctctgtccc tctgcctccc cggaagaaga tgaggaatct gaggattatc agaactcagc atccatccat cagtggcgcg agtccaggaa ggtcatgggg caactccaga gagaagcatc ccctggcccg gtgggaagcc cagacgagga ggacggggaa ccggattacg tgaatgggga ggtggcagcc acagaagcct ag. It is sometimes possible for the material contained within the vial of "LAT2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.