Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

LASP1 cdna clone

LASP1 cDNA Clone

Gene Names
LASP1; MLN50; Lasp-1
Synonyms
LASP1; LASP1 cDNA Clone; LASP1 cdna clone
Ordering
For Research Use Only!
Sequence
atgaaccccaactgcgcccggtgcggcaagatcgtgtatcccacggagaaggtgaactgtctggataagttctggcataaagcatgcttccattgcgagacctgcaagatgacactgaacatgaagaactacaagggctacgagaagaagccctactgcaacgcacactaccccaagcagtccttcaccatggtggcggacaccccggaaaaccttcgcctcaagcaacagagtgagctccagagtcaggtgcgctacaaggaggagtttgagaagaacaagggcaaaggtttcagcgtagtggcagacacgcccgagctccagagaatcaagaagacccaggaccagatcagtaacataaaataccatgaggagtttgagaagagccgcatgggccctagcgggggcgagggcatggagccagagcgtcgggattcgcaggacggcagcagctaccggcggcccctggagcagcagcagcctcaccacatcccgaccagtgccccggtttaccagcagccccagcagcagccggtggcccagtcctatggtggctacaaggagcctgcagccccagtctccatacagcgcagcgcccccatctgtcttcagcacattccacggcatcgcatccgtcctgggcgtgacccgtccattcttcagtgtctctgttttttaaaacctgcgacagcttgtgattcctacccctcttccagcttcttttgccaactgaagccttcttctgccacttctgcgggctccctcctctggcaggcttcccccttgatcgacttcttggttttctctctggatggaacgggcatgggcctctctgggggagggcgaggcccgtggggcagggctggaatgggagacctgttggcctgtgggcctcacctgcccctctgttctctcccctcacatcctcctgcccagctcctcacatacccacacattccagggctggggtga
Sequence Length
972
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
23,181 Da
NCBI Official Full Name
Homo sapiens LIM and SH3 protein 1, mRNA
NCBI Official Synonym Full Names
LIM and SH3 protein 1
NCBI Official Symbol
LASP1
NCBI Official Synonym Symbols
MLN50; Lasp-1
NCBI Protein Information
LIM and SH3 domain protein 1
UniProt Protein Name
LIM and SH3 domain protein 1
UniProt Gene Name
LASP1
UniProt Synonym Gene Names
MLN50; LASP-1; MLN 50
UniProt Entry Name
LASP1_HUMAN

NCBI Description

This gene encodes a member of a subfamily of LIM proteins, characterized by a LIM motif and a domain of Src homology region 3, and also a member of the nebulin family of actin-binding proteins. The encoded protein is a cAMP and cGMP dependent signaling protein and binds to the actin cytoskeleton at extensions of the cell membrane. The encoded protein has been linked to metastatic breast cancer, hematopoetic tumors such as B-cell lymphomas, and colorectal cancer. [provided by RefSeq, Oct 2012]

Uniprot Description

Lasp-1: a member of the LIM protein subfamily, characterized by a LIM motif and SH3 domain. Functions as an actin-binding protein, possibly in cytoskeletal organization.

Protein type: Motility/polarity/chemotaxis; Actin-binding

Chromosomal Location of Human Ortholog: 17q11-q21.3

Cellular Component: cell-cell adherens junction; cortical actin cytoskeleton; cytoplasm; focal adhesion

Molecular Function: ion transmembrane transporter activity; protein binding; SH3/SH2 adaptor activity

Biological Process: ion transport

Research Articles on LASP1

Similar Products

Product Notes

The LASP1 lasp1 (Catalog #AAA1278647) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaacccca actgcgcccg gtgcggcaag atcgtgtatc ccacggagaa ggtgaactgt ctggataagt tctggcataa agcatgcttc cattgcgaga cctgcaagat gacactgaac atgaagaact acaagggcta cgagaagaag ccctactgca acgcacacta ccccaagcag tccttcacca tggtggcgga caccccggaa aaccttcgcc tcaagcaaca gagtgagctc cagagtcagg tgcgctacaa ggaggagttt gagaagaaca agggcaaagg tttcagcgta gtggcagaca cgcccgagct ccagagaatc aagaagaccc aggaccagat cagtaacata aaataccatg aggagtttga gaagagccgc atgggcccta gcgggggcga gggcatggag ccagagcgtc gggattcgca ggacggcagc agctaccggc ggcccctgga gcagcagcag cctcaccaca tcccgaccag tgccccggtt taccagcagc cccagcagca gccggtggcc cagtcctatg gtggctacaa ggagcctgca gccccagtct ccatacagcg cagcgccccc atctgtcttc agcacattcc acggcatcgc atccgtcctg ggcgtgaccc gtccattctt cagtgtctct gttttttaaa acctgcgaca gcttgtgatt cctacccctc ttccagcttc ttttgccaac tgaagccttc ttctgccact tctgcgggct ccctcctctg gcaggcttcc cccttgatcg acttcttggt tttctctctg gatggaacgg gcatgggcct ctctggggga gggcgaggcc cgtggggcag ggctggaatg ggagacctgt tggcctgtgg gcctcacctg cccctctgtt ctctcccctc acatcctcct gcccagctcc tcacataccc acacattcca gggctggggt ga. It is sometimes possible for the material contained within the vial of "LASP1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.