L3MBTL4 cdna clone
L3MBTL4 cDNA Clone
Gene Names
L3MBTL4; HsT1031
Synonyms
L3MBTL4; L3MBTL4 cDNA Clone; L3MBTL4 cdna clone
Sequence
atgaaacagcccaacaggaaaaggaagcttaatatggattccaaagagcgtttggatcaggacggacgcttggagcaagctgaagaggaaaagaagcccaaggatagcacaacccctttgagtcacgtcccttcagcggctgcacagggagcatggtcttgggagtggtacttgaaagaacagaaggctgtcgcagcacctgttgagctgttttccaaggatcagtcctttccagagcatgaaaatggttttcagattggaatgagattagaaggcattgatccccgacatccatcggtattctgtgtgctttctgtagcggaggtttgtggttaccgtctaagacttcattttgatggttatttaagttgctatgatttttggaccaatgctggttcccctgacattcatccagtaggatggtgtgaaaagaccaaacatgaactgcacatccctaagggttatagaaaagataaatttgtttggatggattacttgaaggcctgcaaattgcaaaatgctccaaagaaattattcagaaacagaagtcctaatgggccaatgtctaaagaatttcaggttggaatgaagctggaggccgtggacaggaagaacccttccttggtgtgtgtggcgaccatagcagatattgttgaagatcgcttactagtgcattttgacaactgggatgatagttacgattactggtgcgatgttaatagcccttatgtccagccagttggttggtgtcaggagaatggaagaactctgatagcaccccaaggttatcccaatccagaaaatttttcctggacagaatacctggaagctactcaaaccaatgcagttcctgccaaagtttttaaaatgaggttgcctcatggttttctgccaaatatgaaacttgaagttgtggataaacggaaccccaggttaattcgtgttgctacgattgtagatgttgatgaccaaagagtaaaggttcattttgatggttgggaccataagtatgactactgggtggaggcagacagccctgatatccacccgatcggatggtgtgatgtcacagggcatccactggaagtgccacagcgaacgaatgacctgaagatccttccaggtcaagctgtctgtcctactcccgggtgccgaggaataggccatatccgtggtccacgttattcgggacatcacagtgcttttggctgcccgtattcagacatgaacttgaaaaaggaggcaacacttcacgatcgtttgagagaacaaacacaggcaaatttggaatcagactcttcacattcaaaatcaaaaagcctctgtagtttgaacttcaatggaaaacatgaaaaggtgaacagtcagcccagacttgtacagcaggcaaagtgtttgaaaatcaaaggaaaagaagatattgacttggataatctcttcagaggccgagtgcggtggctcatgcctgtaatcccagcactttgggaggccgaggcaggcagatcacgagatcaggagatcaagaccatcctggccaacgcagtgaaaccccgtctctaccaaaaatacaaaaaattagccaggcgtggtggcgggtgcctatag
Sequence Length
1605
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
61,256 Da
NCBI Official Full Name
Homo sapiens l(3)mbt-like 4 (Drosophila), mRNA
NCBI Official Synonym Full Names
l(3)mbt-like 4 (Drosophila)
NCBI Official Symbol
L3MBTL4
NCBI Official Synonym Symbols
HsT1031
NCBI Protein Information
lethal(3)malignant brain tumor-like protein 4
UniProt Protein Name
Lethal(3)malignant brain tumor-like protein 4
Protein Family
UniProt Gene Name
L3MBTL4
UniProt Synonym Gene Names
H-l(3)mbt-like protein 4; L(3)mbt-like protein 4
UniProt Entry Name
LMBL4_HUMAN
Uniprot Description
L3MBTL4: Putative Polycomb group (PcG) protein. PcG proteins maintain the transcriptionally repressive state of genes, probably via a modification of chromatin, rendering it heritably changed in its expressibility. 2 isoforms of the human protein are produced by alternative splicing.
Chromosomal Location of Human Ortholog: 18p11.31
Molecular Function: protein binding
Research Articles on L3MBTL4
Similar Products
Product Notes
The L3MBTL4 l3mbtl4 (Catalog #AAA1266977) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaaacagc ccaacaggaa aaggaagctt aatatggatt ccaaagagcg tttggatcag gacggacgct tggagcaagc tgaagaggaa aagaagccca aggatagcac aacccctttg agtcacgtcc cttcagcggc tgcacaggga gcatggtctt gggagtggta cttgaaagaa cagaaggctg tcgcagcacc tgttgagctg ttttccaagg atcagtcctt tccagagcat gaaaatggtt ttcagattgg aatgagatta gaaggcattg atccccgaca tccatcggta ttctgtgtgc tttctgtagc ggaggtttgt ggttaccgtc taagacttca ttttgatggt tatttaagtt gctatgattt ttggaccaat gctggttccc ctgacattca tccagtagga tggtgtgaaa agaccaaaca tgaactgcac atccctaagg gttatagaaa agataaattt gtttggatgg attacttgaa ggcctgcaaa ttgcaaaatg ctccaaagaa attattcaga aacagaagtc ctaatgggcc aatgtctaaa gaatttcagg ttggaatgaa gctggaggcc gtggacagga agaacccttc cttggtgtgt gtggcgacca tagcagatat tgttgaagat cgcttactag tgcattttga caactgggat gatagttacg attactggtg cgatgttaat agcccttatg tccagccagt tggttggtgt caggagaatg gaagaactct gatagcaccc caaggttatc ccaatccaga aaatttttcc tggacagaat acctggaagc tactcaaacc aatgcagttc ctgccaaagt ttttaaaatg aggttgcctc atggttttct gccaaatatg aaacttgaag ttgtggataa acggaacccc aggttaattc gtgttgctac gattgtagat gttgatgacc aaagagtaaa ggttcatttt gatggttggg accataagta tgactactgg gtggaggcag acagccctga tatccacccg atcggatggt gtgatgtcac agggcatcca ctggaagtgc cacagcgaac gaatgacctg aagatccttc caggtcaagc tgtctgtcct actcccgggt gccgaggaat aggccatatc cgtggtccac gttattcggg acatcacagt gcttttggct gcccgtattc agacatgaac ttgaaaaagg aggcaacact tcacgatcgt ttgagagaac aaacacaggc aaatttggaa tcagactctt cacattcaaa atcaaaaagc ctctgtagtt tgaacttcaa tggaaaacat gaaaaggtga acagtcagcc cagacttgta cagcaggcaa agtgtttgaa aatcaaagga aaagaagata ttgacttgga taatctcttc agaggccgag tgcggtggct catgcctgta atcccagcac tttgggaggc cgaggcaggc agatcacgag atcaggagat caagaccatc ctggccaacg cagtgaaacc ccgtctctac caaaaataca aaaaattagc caggcgtggt ggcgggtgcc tatag. It is sometimes possible for the material contained within the vial of "L3MBTL4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
