Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

L3MBTL2 cdna clone

L3MBTL2 cDNA Clone

Gene Names
L3MBTL2; L3MBT; H-l(3)mbt-l
Synonyms
L3MBTL2; L3MBTL2 cDNA Clone; L3MBTL2 cdna clone
Ordering
For Research Use Only!
Sequence
atggagaagccccggagtattgaggagaccccatcttcagaaccaatggaggaagaggaagatgacgacttggagctgtttggtggctatgatagtttccggagttataacagcagtgtgggcagtgagagcagctcctatctggaggagtcaagtgaagcagaaaatgaggatcgggaagcaggggaactgccgacctccccgctgcatttgctcagccctgggactcctcgctccttggatggcagtggttctgagccagctgtctgtgagatgtgtggtatcgtgggtacaagggaagccttcttctccaagaccaagaggttctgcagcgtctcctgctccaggagctactcctccaactccaagaaagccagtatcttggctagattacagggaaaaccaccgaccaaaaaagccaaagtcctgcacaaggctgcctggtctgccaaaattggagccttcctccactctcaagggacaggacagctggcagatgggacaccaacaggacaagacgctctggtcttgggcttcgactgggggaagttcctgaaggatcacagttacaaggctgctcccgtcagctgtttcaagcacgtcccactctatgaccagtgggaggatgtgatgaaagggatgaaggtggaggtgctcaacagtgatgctgtgctccccagccgggtgtactggatcgcctctgtcatccagacagcagggtatcgggtgctgcttcggtatgaaggctttgaaaatgacgccagccatgacttctggtgcaacctgggaacagtggatgtccaccccattggctggtgtgccatcaacagcaagatcctagtgcccccacggaccatccatgccaagttcaccgactggaagggctacctcatgaaacggctggtgggctccaggacgcttcccgtggatttccacatcaagatggtggagagcatgaagtacccctttaggcagggcatgcggctggaagtggtggacaagtcccaggtgtcacgcactcgcatggctgtggtggacacagtaatcgggggtcgcctacggctcctctacgaggatggtgacagtgacgacgacttctggtgccacatgtggagccccctgatccacccagtgggttggtcacgacgtgtgggccacggcatcaagatgtcagagaggcgaagtgacatggcccatcaccccaccttccggaagatctactgtgatgccgttccttacctcttcaagaaggtacgagcagtctacacagaaggcggttggtttgaggaagggatgaagctggaggccattgaccccctgaatctgggcaacatctgcgtggcaactgtctgtaaggttctcctggatggatacctgatgatctgtgtggacggggggccctccacagatggcttggactggttctgctaccatgcctcttcccacgccatcttcccggccaccttctgtcagaagaatgacattgagctcacaccgccaaaaggttatgaggcacagactttcaactgggagaactacttggagaagaccaagtcgaaagccgctccatcgagactctttaacatggattgcccaaaccatggcttcaaggtgggcatgaagctggaggccgtggacctgatggagccccggctcatctgtgtggccacggtgaaacgagtggtgcatcggctcctcagcatccactttgacggctgggacagcgagtacgaccagtgggtggactgcgagtccccagacatctaccccgtcggctggtgtgagctcaccggctaccagctccagcctcctgtggccgcagaaccggccacaccgctgaaggccaaagaggccacaaagaagaaaaagaaacagtttgggaagaaaaggaaaagaatcccgcccactaagacgcgacccctcagacaggggtccaagaagcccctgctggaggacgaccctcagggtgccaggaagatctcgtcggagcctgttcctggcgagatcattgctgtgcgtgtgaaggaagagcatctagacgtggcctcgcccgacaaggcttcaagtccagagctgcctgtctccgtcgagaacatcaagcaggaaacagacgactga
Sequence Length
2118
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
69,264 Da
NCBI Official Full Name
Homo sapiens l(3)mbt-like 2 (Drosophila), mRNA
NCBI Official Synonym Full Names
L3MBTL2 polycomb repressive complex 1 subunit
NCBI Official Symbol
L3MBTL2
NCBI Official Synonym Symbols
L3MBT; H-l(3)mbt-l
NCBI Protein Information
lethal(3)malignant brain tumor-like protein 2
UniProt Protein Name
Lethal(3)malignant brain tumor-like protein 2
UniProt Gene Name
L3MBTL2
UniProt Synonym Gene Names
H-l(3)mbt-like protein 2; L(3)mbt-like protein 2
UniProt Entry Name
LMBL2_HUMAN

Uniprot Description

L3MBTL2: Putative Polycomb group (PcG) protein. PcG proteins maintain the transcriptionally repressive state of genes, probably via a modification of chromatin, rendering it heritably changed in its expressibility. Its association with a chromatin-remodeling complex suggests that it may contribute to prevent expression of genes that trigger the cell into mitosis. Binds to monomethylated and dimethylated 'Lys-20' on histone H4. Binds histone H3 peptides that are monomethylated or dimethylated on 'Lys-4', 'Lys-9' or 'Lys-27'. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Histone-binding

Chromosomal Location of Human Ortholog: 22q13.31-q13.33

Cellular Component: nucleoplasm; nucleus

Molecular Function: histone binding; methylated histone residue binding; protein binding

Biological Process: protein sumoylation

Research Articles on L3MBTL2

Similar Products

Product Notes

The L3MBTL2 l3mbtl2 (Catalog #AAA1272694) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagaagc cccggagtat tgaggagacc ccatcttcag aaccaatgga ggaagaggaa gatgacgact tggagctgtt tggtggctat gatagtttcc ggagttataa cagcagtgtg ggcagtgaga gcagctccta tctggaggag tcaagtgaag cagaaaatga ggatcgggaa gcaggggaac tgccgacctc cccgctgcat ttgctcagcc ctgggactcc tcgctccttg gatggcagtg gttctgagcc agctgtctgt gagatgtgtg gtatcgtggg tacaagggaa gccttcttct ccaagaccaa gaggttctgc agcgtctcct gctccaggag ctactcctcc aactccaaga aagccagtat cttggctaga ttacagggaa aaccaccgac caaaaaagcc aaagtcctgc acaaggctgc ctggtctgcc aaaattggag ccttcctcca ctctcaaggg acaggacagc tggcagatgg gacaccaaca ggacaagacg ctctggtctt gggcttcgac tgggggaagt tcctgaagga tcacagttac aaggctgctc ccgtcagctg tttcaagcac gtcccactct atgaccagtg ggaggatgtg atgaaaggga tgaaggtgga ggtgctcaac agtgatgctg tgctccccag ccgggtgtac tggatcgcct ctgtcatcca gacagcaggg tatcgggtgc tgcttcggta tgaaggcttt gaaaatgacg ccagccatga cttctggtgc aacctgggaa cagtggatgt ccaccccatt ggctggtgtg ccatcaacag caagatccta gtgcccccac ggaccatcca tgccaagttc accgactgga agggctacct catgaaacgg ctggtgggct ccaggacgct tcccgtggat ttccacatca agatggtgga gagcatgaag taccccttta ggcagggcat gcggctggaa gtggtggaca agtcccaggt gtcacgcact cgcatggctg tggtggacac agtaatcggg ggtcgcctac ggctcctcta cgaggatggt gacagtgacg acgacttctg gtgccacatg tggagccccc tgatccaccc agtgggttgg tcacgacgtg tgggccacgg catcaagatg tcagagaggc gaagtgacat ggcccatcac cccaccttcc ggaagatcta ctgtgatgcc gttccttacc tcttcaagaa ggtacgagca gtctacacag aaggcggttg gtttgaggaa gggatgaagc tggaggccat tgaccccctg aatctgggca acatctgcgt ggcaactgtc tgtaaggttc tcctggatgg atacctgatg atctgtgtgg acggggggcc ctccacagat ggcttggact ggttctgcta ccatgcctct tcccacgcca tcttcccggc caccttctgt cagaagaatg acattgagct cacaccgcca aaaggttatg aggcacagac tttcaactgg gagaactact tggagaagac caagtcgaaa gccgctccat cgagactctt taacatggat tgcccaaacc atggcttcaa ggtgggcatg aagctggagg ccgtggacct gatggagccc cggctcatct gtgtggccac ggtgaaacga gtggtgcatc ggctcctcag catccacttt gacggctggg acagcgagta cgaccagtgg gtggactgcg agtccccaga catctacccc gtcggctggt gtgagctcac cggctaccag ctccagcctc ctgtggccgc agaaccggcc acaccgctga aggccaaaga ggccacaaag aagaaaaaga aacagtttgg gaagaaaagg aaaagaatcc cgcccactaa gacgcgaccc ctcagacagg ggtccaagaa gcccctgctg gaggacgacc ctcagggtgc caggaagatc tcgtcggagc ctgttcctgg cgagatcatt gctgtgcgtg tgaaggaaga gcatctagac gtggcctcgc ccgacaaggc ttcaagtcca gagctgcctg tctccgtcga gaacatcaag caggaaacag acgactga. It is sometimes possible for the material contained within the vial of "L3MBTL2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.