Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

Vector Map

KLK5 cdna clone

KLK5 cDNA Clone

Gene Names
KLK5; SCTE; KLKL2; KLK-L2
Synonyms
KLK5; KLK5 cDNA Clone; KLK5 cdna clone
Ordering
For Research Use Only!
Sequence
atggctacagcaagacccccctggatgtgggtgctctgtgctctgatcacagccttgcttctgggggtcacagagcatgttctcgccaacaatgatgtttcctgtgaccacccctctaacaccgtgccctctgggagcaaccaggacctgggagctggggccggggaagacgcccggtcggatgacagcagcagccgcatcatcaatggatccgactgcgatatgcacacccagccgtggcaggccgcgctgttgctaaggcccaaccagctctactgcggggcggtgttggtgcatccacagtggctgctcacggccgcccactgcaggaagaaagttttcagagtccgtctcggccactactccctgtcaccagtttatgaatctgggcagcagatgttccagggggtcaaatccatcccccaccctggctactcccaccctggccactctaacgacctcatgctcatcaaactgaacagaagaattcgtcccactaaagatgtcagacccatcaacgtctcctctcattgtccctctgctgggacaaagtgcttggtgtctggctgggggacaaccaagagcccccaagtgcacttccctaaggtcctccagtgcttgaatatcagcgtgctaagtcagaaaaggtgcgaggatgcttacccgagacagatagatgacaccatgttctgcgccggtgacaaagcaggtagagactcctgccagggtgattctggggggcctgtggtctgcaatggctccctgcagggactcgtgtcctggggagattacccttgtgcccggcccaacagaccgggtgtctacacgaacctctgcaagttcaccaagtggatccaggaaaccatccaggccaactcctga
Sequence Length
882
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

Vector Map

Vector Map

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
32,019 Da
NCBI Official Full Name
Homo sapiens kallikrein-related peptidase 5, mRNA
NCBI Official Synonym Full Names
kallikrein related peptidase 5
NCBI Official Symbol
KLK5
NCBI Official Synonym Symbols
SCTE; KLKL2; KLK-L2
NCBI Protein Information
kallikrein-5
UniProt Protein Name
Kallikrein-5
Protein Family
UniProt Gene Name
KLK5
UniProt Synonym Gene Names
SCTE; KLK-L2
UniProt Entry Name
KLK5_HUMAN

NCBI Description

Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. This gene is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. Its expression is up-regulated by estrogens and progestins. The encoded protein is secreted and may be involved in desquamation in the epidermis. Alternative splicing results in multiple transcript variants encoding the same protein. [provided by RefSeq, Jul 2008]

Uniprot Description

KLK5: May be involved in desquamation. Belongs to the peptidase S1 family. Kallikrein subfamily.

Protein type: Secreted; Protease; Secreted, signal peptide; EC 3.4.21.-

Chromosomal Location of Human Ortholog: 19q13.33

Cellular Component: extracellular space

Molecular Function: peptidase activity; protein binding; serine-type endopeptidase activity; serine-type peptidase activity

Biological Process: epidermis development; positive regulation of antibacterial peptide production; positive regulation of G-protein coupled receptor protein signaling pathway

Research Articles on KLK5

Similar Products

Product Notes

The KLK5 klk5 (Catalog #AAA1271788) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctacag caagaccccc ctggatgtgg gtgctctgtg ctctgatcac agccttgctt ctgggggtca cagagcatgt tctcgccaac aatgatgttt cctgtgacca cccctctaac accgtgccct ctgggagcaa ccaggacctg ggagctgggg ccggggaaga cgcccggtcg gatgacagca gcagccgcat catcaatgga tccgactgcg atatgcacac ccagccgtgg caggccgcgc tgttgctaag gcccaaccag ctctactgcg gggcggtgtt ggtgcatcca cagtggctgc tcacggccgc ccactgcagg aagaaagttt tcagagtccg tctcggccac tactccctgt caccagttta tgaatctggg cagcagatgt tccagggggt caaatccatc ccccaccctg gctactccca ccctggccac tctaacgacc tcatgctcat caaactgaac agaagaattc gtcccactaa agatgtcaga cccatcaacg tctcctctca ttgtccctct gctgggacaa agtgcttggt gtctggctgg gggacaacca agagccccca agtgcacttc cctaaggtcc tccagtgctt gaatatcagc gtgctaagtc agaaaaggtg cgaggatgct tacccgagac agatagatga caccatgttc tgcgccggtg acaaagcagg tagagactcc tgccagggtg attctggggg gcctgtggtc tgcaatggct ccctgcaggg actcgtgtcc tggggagatt acccttgtgc ccggcccaac agaccgggtg tctacacgaa cctctgcaag ttcaccaagt ggatccagga aaccatccag gccaactcct ga. It is sometimes possible for the material contained within the vial of "KLK5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.