KLHL9 cdna clone
KLHL9 cDNA Clone
Synonyms
KLHL9; KLHL9 cDNA Clone; KLHL9 cdna clone
Sequence
atgaaagtgtcccttggtaacggcgaaatgggcgtctctgcccatttgcagccttgtaaggcaggaaccacacgcttttttaccagcaatactcacagttcggtggtattgcaaggctttgatcagcttagaatagaaggattgctttgtgatgtgaccctggtaccaggtgatggagatgaaatcttccctgttcacagagctatgatggcgtctgctagtgattatttcaaagccatgttcacaggtggaatgaaagaacaagatttgatgtgcattaagcttcatggggtgaacaaggttggtctgaagaaaatcattgattttatttatactgcaaaactttctcttaatatggacaatcttcaggacacacttgaagctgctagctttttacaaatattacccgttttggatttctgtaaagtatttcttatatcaggagtctctttggataactgtgttgaggttggacgaattgctaacacctacaatcttatagaagtggataaatatgttaataatttcatcctgaagaactttcctgctttattgagtactggggagtttctaaaactcccttttgaacgacttgcatttgtgctttccagtaatagtcttaagcactgtaccgaacttgaactctttaaggcagcctgtcgctggctaaggttggaagaccctcggatggattatgctgcaaagttaatgaagaatattcgatttccactgatgacaccacaggatctcatcaattacgtgcagacagtagatttcatgagaacagacaatacctgcgtgaatttgcttttggaagctagcaattaccaaatgatgccatatatgcagccagtgatgcagtcagatagaactgccattcgatctgactccactcacttggttacattaggaggagttttgaggcagcagctggttgtcagtaaagaattacggatgtatgatgaaagggcacaagaatggagatctttagccccaatggatgctccccgttaccagcatggtattgctgtcattggaaactttctttatgtagttggtggtcagagtaattatgatacaaaaggaaaaactgctgttgatacagttttcagatttgatcctcggtataataaatggatgcaggttgcatcattaaatgaaaagcgcacattctttcacttgagtgccctcaaaggacatttgtatgcagttggtgggcgcagtgcagctggtgaactggccacagtagaatgttacaacccaagaatgaatgagtggagctatgttgcaaaaatgagtgaaccccactatggtcatgctggaacagtatatggaggcttaatgtatatttcaggaggaattacccatgacactttccaaaatgagctcatgtgttttgacccagatacagataaatggatgcaaaaggctccaatgactacagtcagaggtctgcattgcatgtgtacagttggagataagctctatgtcattggtggcaatcacttcagaggaacaagtgattatgatgatgttctaagctgtgaatactattcaccaacccttgaccagtggaccccaattgccgccatgttaagaggccaaagtgatgttggagttgccgtctttgaaaataaaatctatgttgttggtggatattcttggaataatcgttgtatggtagaaattgtccagaaatatgacccagaaaaagatgagtggcataaagtttttgatcttccagagtcacttggtggcattcgagcctgtacactcacagtttttccacctgaagaaaaccctgggtcaccttctagagaatcacctctttcagcaccttcagatcattcttag
Sequence Length
1854
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
69,429 Da
NCBI Official Full Name
Homo sapiens kelch-like 9 (Drosophila), mRNA
NCBI Official Synonym Full Names
kelch like family member 9
NCBI Official Symbol
KLHL9
NCBI Protein Information
kelch-like protein 9
UniProt Protein Name
Kelch-like protein 9
Protein Family
UniProt Gene Name
KLHL9
UniProt Synonym Gene Names
KIAA1354
UniProt Entry Name
KLHL9_HUMAN
NCBI Description
This gene encodes a protein that belongs to the kelch repeat-containing family, and contains an N-terminal BTB/POZ domain, a BACK domain and six C-terminal kelch repeats. The encoded protein is a component of a complex with cullin 3-based E3 ligase, which plays a role in mitosis. This protein complex is a cell cycle regulator, and functions in the organization and integrity of the spindle midzone in anaphase and the completion of cytokinesis. The complex is required for the removal of the chromosomal passenger protein aurora B from mitotic chromosomes. [provided by RefSeq, Jul 2016]
Uniprot Description
KLHL9: Substrate-specific adapter of a BCR (BTB-CUL3-RBX1) E3 ubiquitin-protein ligase complex required for mitotic progression and cytokinesis. The BCR(KLHL9-KLHL13) E3 ubiquitin ligase complex mediates the ubiquitination of AURKB and controls the dynamic behavior of AURKB on mitotic chromosomes and thereby coordinates faithful mitotic progression and completion of cytokinesis.
Protein type: Ubiquitin conjugating system; Adaptor/scaffold
Chromosomal Location of Human Ortholog: 9p22
Cellular Component: midbody
Molecular Function: ubiquitin-protein ligase activity
Biological Process: cytokinesis; protein ubiquitination
Research Articles on KLHL9
Similar Products
Product Notes
The KLHL9 klhl9 (Catalog #AAA1270747) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaaagtgt cccttggtaa cggcgaaatg ggcgtctctg cccatttgca gccttgtaag gcaggaacca cacgcttttt taccagcaat actcacagtt cggtggtatt gcaaggcttt gatcagctta gaatagaagg attgctttgt gatgtgaccc tggtaccagg tgatggagat gaaatcttcc ctgttcacag agctatgatg gcgtctgcta gtgattattt caaagccatg ttcacaggtg gaatgaaaga acaagatttg atgtgcatta agcttcatgg ggtgaacaag gttggtctga agaaaatcat tgattttatt tatactgcaa aactttctct taatatggac aatcttcagg acacacttga agctgctagc tttttacaaa tattacccgt tttggatttc tgtaaagtat ttcttatatc aggagtctct ttggataact gtgttgaggt tggacgaatt gctaacacct acaatcttat agaagtggat aaatatgtta ataatttcat cctgaagaac tttcctgctt tattgagtac tggggagttt ctaaaactcc cttttgaacg acttgcattt gtgctttcca gtaatagtct taagcactgt accgaacttg aactctttaa ggcagcctgt cgctggctaa ggttggaaga ccctcggatg gattatgctg caaagttaat gaagaatatt cgatttccac tgatgacacc acaggatctc atcaattacg tgcagacagt agatttcatg agaacagaca atacctgcgt gaatttgctt ttggaagcta gcaattacca aatgatgcca tatatgcagc cagtgatgca gtcagataga actgccattc gatctgactc cactcacttg gttacattag gaggagtttt gaggcagcag ctggttgtca gtaaagaatt acggatgtat gatgaaaggg cacaagaatg gagatcttta gccccaatgg atgctccccg ttaccagcat ggtattgctg tcattggaaa ctttctttat gtagttggtg gtcagagtaa ttatgataca aaaggaaaaa ctgctgttga tacagttttc agatttgatc ctcggtataa taaatggatg caggttgcat cattaaatga aaagcgcaca ttctttcact tgagtgccct caaaggacat ttgtatgcag ttggtgggcg cagtgcagct ggtgaactgg ccacagtaga atgttacaac ccaagaatga atgagtggag ctatgttgca aaaatgagtg aaccccacta tggtcatgct ggaacagtat atggaggctt aatgtatatt tcaggaggaa ttacccatga cactttccaa aatgagctca tgtgttttga cccagataca gataaatgga tgcaaaaggc tccaatgact acagtcagag gtctgcattg catgtgtaca gttggagata agctctatgt cattggtggc aatcacttca gaggaacaag tgattatgat gatgttctaa gctgtgaata ctattcacca acccttgacc agtggacccc aattgccgcc atgttaagag gccaaagtga tgttggagtt gccgtctttg aaaataaaat ctatgttgtt ggtggatatt cttggaataa tcgttgtatg gtagaaattg tccagaaata tgacccagaa aaagatgagt ggcataaagt ttttgatctt ccagagtcac ttggtggcat tcgagcctgt acactcacag tttttccacc tgaagaaaac cctgggtcac cttctagaga atcacctctt tcagcacctt cagatcattc ttag. It is sometimes possible for the material contained within the vial of "KLHL9, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
