Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

KLF9 cdna clone

KLF9 cDNA Clone

Gene Names
KLF9; BTEB; BTEB1
Synonyms
KLF9; KLF9 cDNA Clone; KLF9 cdna clone
Ordering
For Research Use Only!
Sequence
atgtccgcggccgcctacatggacttcgtggctgcccagtgtctggtttccatttcgaaccgcgctgcggtgccggagcatggggtcgctccggacgccgagcggctgcgactacctgagcgcgaggtgaccaaggagcacggtgacccgggggacacctggaaggattactgcacactggtcaccatcgccaagagcttgttggacctgaacaagtaccgacccatccagaccccctccgtgtgcagcgacagtctggaaagtccagatgaggatatgggatccgacagcgacgtgaccaccgaatctgggtcgagtccttcccacagcccggaggagagacaggatcctggcagcgcgcccagcccgctctccctcctccatcctggagtggctgcgaaggggaaacacgcctccgaaaagaggcacaagtgcccctacagtggctgtgggaaagtctatggaaaatcctcccatctcaaagcccattacagagtgcatacaggtgaacggccctttccctgcacgtggccagactgccttaaaaagttctcccgctcagacgagctgacccgccactaccggacccacactggggaaaagcagttccgctgtccgctgtgtgagaagcgcttcatgaggagtgaccacctcacaaagcacgcccggcggcacaccgagttccaccccagcatgatcaagcgatcgaaaaaggcgctggccaacgctttgtga
Sequence Length
735
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
687
Molecular Weight
27,235 Da
NCBI Official Full Name
Homo sapiens Kruppel-like factor 9, mRNA
NCBI Official Synonym Full Names
Kruppel like factor 9
NCBI Official Symbol
KLF9
NCBI Official Synonym Symbols
BTEB; BTEB1
NCBI Protein Information
Krueppel-like factor 9
UniProt Protein Name
Krueppel-like factor 9
Protein Family
UniProt Gene Name
KLF9
UniProt Synonym Gene Names
BTEB; BTEB1; BTE-binding protein 1
UniProt Entry Name
KLF9_HUMAN

NCBI Description

The protein encoded by this gene is a transcription factor that binds to GC box elements located in the promoter. Binding of the encoded protein to a single GC box inhibits mRNA expression while binding to tandemly repeated GC box elements activates transcription. [provided by RefSeq, Jul 2008]

Uniprot Description

KLF9: Transcription factor that binds to GC box promoter elements. Selectively activates mRNA synthesis from genes containing tandem repeats of GC boxes but represses genes with a single GC box. Belongs to the Sp1 C2H2-type zinc-finger protein family.

Protein type: DNA-binding; C2H2-type zinc finger protein

Chromosomal Location of Human Ortholog: 9q13

Cellular Component: cytoplasm; nucleoplasm; nucleus; plasma membrane

Molecular Function: transcription factor activity

Biological Process: circadian rhythm; regulation of transcription from RNA polymerase II promoter

Research Articles on KLF9

Similar Products

Product Notes

The KLF9 klf9 (Catalog #AAA1268574) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtccgcgg ccgcctacat ggacttcgtg gctgcccagt gtctggtttc catttcgaac cgcgctgcgg tgccggagca tggggtcgct ccggacgccg agcggctgcg actacctgag cgcgaggtga ccaaggagca cggtgacccg ggggacacct ggaaggatta ctgcacactg gtcaccatcg ccaagagctt gttggacctg aacaagtacc gacccatcca gaccccctcc gtgtgcagcg acagtctgga aagtccagat gaggatatgg gatccgacag cgacgtgacc accgaatctg ggtcgagtcc ttcccacagc ccggaggaga gacaggatcc tggcagcgcg cccagcccgc tctccctcct ccatcctgga gtggctgcga aggggaaaca cgcctccgaa aagaggcaca agtgccccta cagtggctgt gggaaagtct atggaaaatc ctcccatctc aaagcccatt acagagtgca tacaggtgaa cggccctttc cctgcacgtg gccagactgc cttaaaaagt tctcccgctc agacgagctg acccgccact accggaccca cactggggaa aagcagttcc gctgtccgct gtgtgagaag cgcttcatga ggagtgacca cctcacaaag cacgcccggc ggcacaccga gttccacccc agcatgatca agcgatcgaa aaaggcgctg gccaacgctt tgtga. It is sometimes possible for the material contained within the vial of "KLF9, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.