Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

KIR2DL3 cdna clone

KIR2DL3 cDNA Clone

Gene Names
KIR2DL3; p58; NKAT; GL183; NKAT2; CD158b; NKAT2A; NKAT2B; CD158B2; KIR-K7b; KIR-K7c; KIR2DS3; KIR2DS5; KIRCL23; KIR-023GB
Synonyms
KIR2DL3; KIR2DL3 cDNA Clone; KIR2DL3 cdna clone
Ordering
For Research Use Only!
Sequence
atgtcgctcatggtcgtcagcatggtgtgtgttgggttcttcttgctgcagggggcctggccacatgagggagtccacagaaaaccttccctcctggcccacccaggtcccctggtgaaatcagaagagacagtcatcctgcaatgttggtcagatgtcaggtttcagcacttccttctgcacagagaagggaagtttaaggacactttgcacctcattggagagcaccatgatggggtctccaaggccaacttctccatcggtcccatgatgcaagaccttgcagggacctacagatgctacggttctgttactcactccccctatcagttgtcagctcccagtgaccctctggacatcgtcatcacaggtctatatgagaaaccttctctctcagcccagccgggccccacggttctggcaggagagagcgtgaccttgtcctgcagctcccggagctcctatgacatgtaccatctatccagggagggggaggcccatgaacgtaggttctctgcagggcccaaggtcaacggaacattccaggccgactttcctctgggccctgccacccacggaggaacctacagatgcttcggctctttccgtgactctccatacgagtggtcaaactcgagtgacccactgcttgtttctgtcacaggaaacccttcaaatagttggctttcacccactgaaccaagctccgaaaccggtaaccccagacacctgcatgttctgattgggacctcagtggtcatcatcctcttcatcctcctcctcttctttctccttcatcgctggtgctgcaacaaaaaaaatgctgttgtaatggaccaagagcctgcagggaacagaacagtgaacagggaggactctgatgaacaagaccctcaggaggtgacatatgcacagttgaatcactgcgttttcacacagagaaaaatcactcacccttctcagaggcccaagacacccccaacagatatcatcgtgtacacggaacttccaaatgctgagccctga
Sequence Length
1026
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
27,269 Da
NCBI Official Full Name
Homo sapiens killer cell immunoglobulin-like receptor, two domains, long cytoplasmic tail, 3, mRNA
NCBI Official Synonym Full Names
killer cell immunoglobulin like receptor, two Ig domains and long cytoplasmic tail 3
NCBI Official Symbol
KIR2DL3
NCBI Official Synonym Symbols
p58; NKAT; GL183; NKAT2; CD158b; NKAT2A; NKAT2B; CD158B2; KIR-K7b; KIR-K7c; KIR2DS3; KIR2DS5; KIRCL23; KIR-023GB
NCBI Protein Information
killer cell immunoglobulin-like receptor 2DL3
UniProt Protein Name
Killer cell immunoglobulin-like receptor 2DL3
UniProt Gene Name
KIR2DL3
UniProt Synonym Gene Names
CD158B2; KIRCL23; NKAT2; NKAT-2; p58 NK receptor CL-6
UniProt Entry Name
KI2L3_HUMAN

NCBI Description

Killer cell immunoglobulin-like receptors (KIRs) are transmembrane glycoproteins expressed by natural killer cells and subsets of T cells. The KIR genes are polymorphic and highly homologous and they are found in a cluster on chromosome 19q13.4 within the 1 Mb leukocyte receptor complex (LRC). The gene content of the KIR gene cluster varies among haplotypes, although several "framework" genes are found in all haplotypes (KIR3DL3, KIR3DP1, KIR3DL4, KIR3DL2). The KIR proteins are classified by the number of extracellular immunoglobulin domains (2D or 3D) and by whether they have a long (L) or short (S) cytoplasmic domain. KIR proteins with the long cytoplasmic domain transduce inhibitory signals upon ligand binding via an immune tyrosine-based inhibitory motif (ITIM), while KIR proteins with the short cytoplasmic domain lack the ITIM motif and instead associate with the TYRO protein tyrosine kinase binding protein to transduce activating signals. The ligands for several KIR proteins are subsets of HLA class I molecules; thus, KIR proteins are thought to play an important role in regulation of the immune response. [provided by RefSeq, Jul 2008]

Uniprot Description

KIR2DL3: Receptor on natural killer (NK) cells for HLA-C alleles (HLA-Cw1, HLA-Cw3 and HLA-Cw7). Inhibits the activity of NK cells thus preventing cell lysis. Belongs to the immunoglobulin superfamily. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Receptor, misc.

Chromosomal Location of Human Ortholog: 19q13.4

Cellular Component: integral to membrane; integral to plasma membrane; plasma membrane

Molecular Function: antigen binding; protein binding; receptor activity

Biological Process: immune response; regulation of immune response

Research Articles on KIR2DL3

Similar Products

Product Notes

The KIR2DL3 kir2dl3 (Catalog #AAA1269129) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcgctca tggtcgtcag catggtgtgt gttgggttct tcttgctgca gggggcctgg ccacatgagg gagtccacag aaaaccttcc ctcctggccc acccaggtcc cctggtgaaa tcagaagaga cagtcatcct gcaatgttgg tcagatgtca ggtttcagca cttccttctg cacagagaag ggaagtttaa ggacactttg cacctcattg gagagcacca tgatggggtc tccaaggcca acttctccat cggtcccatg atgcaagacc ttgcagggac ctacagatgc tacggttctg ttactcactc cccctatcag ttgtcagctc ccagtgaccc tctggacatc gtcatcacag gtctatatga gaaaccttct ctctcagccc agccgggccc cacggttctg gcaggagaga gcgtgacctt gtcctgcagc tcccggagct cctatgacat gtaccatcta tccagggagg gggaggccca tgaacgtagg ttctctgcag ggcccaaggt caacggaaca ttccaggccg actttcctct gggccctgcc acccacggag gaacctacag atgcttcggc tctttccgtg actctccata cgagtggtca aactcgagtg acccactgct tgtttctgtc acaggaaacc cttcaaatag ttggctttca cccactgaac caagctccga aaccggtaac cccagacacc tgcatgttct gattgggacc tcagtggtca tcatcctctt catcctcctc ctcttctttc tccttcatcg ctggtgctgc aacaaaaaaa atgctgttgt aatggaccaa gagcctgcag ggaacagaac agtgaacagg gaggactctg atgaacaaga ccctcaggag gtgacatatg cacagttgaa tcactgcgtt ttcacacaga gaaaaatcac tcacccttct cagaggccca agacaccccc aacagatatc atcgtgtaca cggaacttcc aaatgctgag ccctga. It is sometimes possible for the material contained within the vial of "KIR2DL3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.