Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

KIAA1530 cdna clone

KIAA1530 cDNA Clone

Gene Names
UVSSA; UVSS3; KIAA1530
Synonyms
KIAA1530; KIAA1530 cDNA Clone; KIAA1530 cdna clone
Ordering
For Research Use Only!
Sequence
atggacgaggaggtgtcggaccccacctctgcggctgctcagctgcggcagctccgggaccacttgcctccaccctcatctgccagcccctccagagcgttgccagagccacaggaggcccagaagctggcagcagagcgggcccgggcgcctgtggtgccctacggcgtggacctgcactactggggccaggagctccccacagccgggaagattgtcaagtctgactcccagcaccgcttctggaagcccagcgaggtggaggaggaagtggtcaatgccgacatctccgagatgctccggagccgccacatcacttttgccgggaagtttgagcctgtgcagcactggtgccgtgccccgaggccagacggccggctctgtgagcgccaagaccggctgaagtgccctttccatgggaagattgttccacgggacgacgaaggacggccgctcgacccggaagacagggctcgtgagcagcggcggcagctgcagaagcaggagcgcccggaatggcaggaccctgagttgatgagagacgtggaagcagccacagggcaggatctcggctcatccaggtacagcgggaaaggcagggggaagaagaggaggtaccccagcctcaccaacctgaaggctcaggctgataccgcccgcgctcgcattgggagaaaagtcttcgccaaggcagctgtgcggagggtagtggcagccatgaaccggatggaccagaagaagcacgagaagttttcaaaccagtttaactacgcactgaactag
Sequence Length
783
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
29,763 Da
NCBI Official Full Name
Homo sapiens KIAA1530, mRNA
NCBI Official Synonym Full Names
UV stimulated scaffold protein A
NCBI Official Symbol
UVSSA
NCBI Official Synonym Symbols
UVSS3; KIAA1530
NCBI Protein Information
UV-stimulated scaffold protein A
UniProt Protein Name
UV-stimulated scaffold protein A
UniProt Gene Name
UVSSA
UniProt Synonym Gene Names
KIAA1530
UniProt Entry Name
UVSSA_HUMAN

NCBI Description

The protein encoded by this gene appears to be involved in ubiquitination and dephosphorylation of RNA polymerase II subunits that stall after UV irradiation. The encoded protein interacts with several members of the nucleotide excision repair complex, and is thought to be involved in the transcription-coupled nucleotide excision repair (TC-NER) pathway to help remove lesions in the DNA that block transcription. Defects in this gene can cause UV-sensitive syndrome 3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]

Uniprot Description

UVSSA: Factor involved in transcription-coupled nucleotide excision repair (TC-NER) in response to UV damage. TC-NER allows RNA polymerase II-blocking lesions to be rapidly removed from the transcribed strand of active genes. Acts by promoting stabilization of ERCC6 by recruiting deubiquitinating enzyme USP7 to TC-NER complexes, preventing UV-induced degradation of ERCC6 by the proteasome. Interacts with the elongating form of RNA polymerase II (RNA pol IIo) and facilitates its ubiquitination at UV damage sites, leading to promote RNA pol IIo backtracking to allow access to the nucleotide excision repair machinery. Not involved in processing oxidative damage. Defects in UVSSA are a cause of UV-sensitive syndrome type 3 (UVSS3). A rare autosomal recessive disorder characterized by photosensitivity and mild freckling but without neurological abnormalities or skin tumors. Belongs to the UVSSA family. 2 isoforms of the human protein are produced by alternative splicing.

Chromosomal Location of Human Ortholog: 4p16.3

Cellular Component: chromosome; nucleoplasm

Molecular Function: protein binding

Biological Process: protein ubiquitination; response to UV; transcription-coupled nucleotide-excision repair

Disease: Uv-sensitive Syndrome 3

Research Articles on KIAA1530

Similar Products

Product Notes

The KIAA1530 uvssa (Catalog #AAA1278535) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggacgagg aggtgtcgga ccccacctct gcggctgctc agctgcggca gctccgggac cacttgcctc caccctcatc tgccagcccc tccagagcgt tgccagagcc acaggaggcc cagaagctgg cagcagagcg ggcccgggcg cctgtggtgc cctacggcgt ggacctgcac tactggggcc aggagctccc cacagccggg aagattgtca agtctgactc ccagcaccgc ttctggaagc ccagcgaggt ggaggaggaa gtggtcaatg ccgacatctc cgagatgctc cggagccgcc acatcacttt tgccgggaag tttgagcctg tgcagcactg gtgccgtgcc ccgaggccag acggccggct ctgtgagcgc caagaccggc tgaagtgccc tttccatggg aagattgttc cacgggacga cgaaggacgg ccgctcgacc cggaagacag ggctcgtgag cagcggcggc agctgcagaa gcaggagcgc ccggaatggc aggaccctga gttgatgaga gacgtggaag cagccacagg gcaggatctc ggctcatcca ggtacagcgg gaaaggcagg gggaagaaga ggaggtaccc cagcctcacc aacctgaagg ctcaggctga taccgcccgc gctcgcattg ggagaaaagt cttcgccaag gcagctgtgc ggagggtagt ggcagccatg aaccggatgg accagaagaa gcacgagaag ttttcaaacc agtttaacta cgcactgaac tag. It is sometimes possible for the material contained within the vial of "KIAA1530, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.