KIAA1191 cdna clone
KIAA1191 cDNA Clone
Gene Names
KIAA1191; p33MONOX; p60MONOX
Synonyms
KIAA1191; KIAA1191 cDNA Clone; KIAA1191 cdna clone
Sequence
atggcttcaagacaaccagaagtgcctgctcttgaggctagtgcgcctctaggcaagatgtccctgcccatcgggatataccgccgggcagtcagctatgatgataccctcgaggaccctgcgcccatgactcctcctccatcggacatgggcagcgtcccttggaagccagtgattccagagcgcaagtatcagcacctcgccaaggtggaggaaggagaggccagtctaccctcccctgccatgaccctgtcatcagccattgacagtgtggacaaggtcccagtggtgaaggctaaagctacccatgtcatcatgaattctctgatcacaaaacagacccaggaaagcattcagcattttgagcgacaggcagggctgagagatgctggctacacaccccacaagggcctcaccaccgaggagaccaagtaccttcgagtggccgaagcactccacaaactaaagttacagagtggagaggtaacaaaagaagagaggcagcctgcatcagcccagtccaccccaagcaccactccgcactcttcacctaagcagaggcccaggggctggttcacttctggttcttccacagccttacctggcccaaatcctagcaccatggactctggaagtggggataaggacagaaacttgtcagataagtggagcctctttggaccgagatcccttcagaagtacgattctggaagttttgccacccaggcctaccgaggagcccagaagccctctccattggaactgatacgtgcccaggccaaccgaatggctgaagatccagcagccttgaagccccccaagatggacatcccagtgatggaaggaaagaaacagccaccacgggcccataacctcaaaccccgtgacctgaatgtgctcacacccactggcttctag
Sequence Length
918
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
10,836 Da
NCBI Official Full Name
Homo sapiens KIAA1191, mRNA
NCBI Official Synonym Full Names
KIAA1191
NCBI Official Symbol
KIAA1191
NCBI Official Synonym Symbols
p33MONOX; p60MONOX
NCBI Protein Information
putative monooxygenase p33MONOX
UniProt Protein Name
Putative monooxygenase p33MONOX
UniProt Gene Name
KIAA1191
UniProt Synonym Gene Names
P33MONOX
UniProt Entry Name
P33MX_HUMAN
Uniprot Description
KIAA1191: Potential NADPH-dependent oxidoreductase. May be involved in the regulation of neuronal survival, differentiation and axonal outgrowth. Belongs to the P33MONOX family. 3 isoforms of the human protein are produced by alternative splicing.
Protein type: EC 1.-.-.-
Chromosomal Location of Human Ortholog: 5q35.2
Cellular Component: cytoplasm
Molecular Function: protein binding
Research Articles on KIAA1191
Similar Products
Product Notes
The KIAA1191 kiaa1191 (Catalog #AAA1273099) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcttcaa gacaaccaga agtgcctgct cttgaggcta gtgcgcctct aggcaagatg tccctgccca tcgggatata ccgccgggca gtcagctatg atgataccct cgaggaccct gcgcccatga ctcctcctcc atcggacatg ggcagcgtcc cttggaagcc agtgattcca gagcgcaagt atcagcacct cgccaaggtg gaggaaggag aggccagtct accctcccct gccatgaccc tgtcatcagc cattgacagt gtggacaagg tcccagtggt gaaggctaaa gctacccatg tcatcatgaa ttctctgatc acaaaacaga cccaggaaag cattcagcat tttgagcgac aggcagggct gagagatgct ggctacacac cccacaaggg cctcaccacc gaggagacca agtaccttcg agtggccgaa gcactccaca aactaaagtt acagagtgga gaggtaacaa aagaagagag gcagcctgca tcagcccagt ccaccccaag caccactccg cactcttcac ctaagcagag gcccaggggc tggttcactt ctggttcttc cacagcctta cctggcccaa atcctagcac catggactct ggaagtgggg ataaggacag aaacttgtca gataagtgga gcctctttgg accgagatcc cttcagaagt acgattctgg aagttttgcc acccaggcct accgaggagc ccagaagccc tctccattgg aactgatacg tgcccaggcc aaccgaatgg ctgaagatcc agcagccttg aagcccccca agatggacat cccagtgatg gaaggaaaga aacagccacc acgggcccat aacctcaaac cccgtgacct gaatgtgctc acacccactg gcttctag. It is sometimes possible for the material contained within the vial of "KIAA1191, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
