Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

KIAA0020 cdna clone

KIAA0020 cDNA Clone

Gene Names
PUM3; PEN; HA-8; PUF6; XTP5; PUF-A; HLA-HA8; KIAA0020
Synonyms
KIAA0020; KIAA0020 cDNA Clone; KIAA0020 cdna clone
Ordering
For Research Use Only!
Sequence
atggaagttaaagggaaaaagcaattcacaggaaagaatacaaagacagcacaagaaaaaaacagatttcataaaaatagtgattctggttcttcaaagacatttccaacaaggaaagttgctaaagaaggtggacctaaagtcacatctaggaactttgagaaaagtatcacaaaacttgggaaaaagggtgtaaagcagttcaagaataagcagcaaggggacaaatcaccaaagaacaaattccagccggcaaataaattcaacaagaagagaaaattccagccagatggtagaagcgatgaatcagcagccaagaagcccaaatgggatgacttcaaaaagaagaagaaagaactgaagcaaagcagacaactcagtgataaaaccaactatgacattgttgttcgggcaaagcagatgtgggagattttaagaagaaaagactgtgacaaagaaaaaagagtaaagttaatgagtgatttgcagaagttgattcaagggaaaattaaaactattgcatttgcacacgattcaactcgtgtgatccagtgttacattcagtatggtaatgaagaacagagaaaacaggcttttgaagaattgcgagatgatttggttgagttaagtaaagccaaatattcgagaaatattgttaagaaatttctcatgtatggaagtaaaccacagattgcagagataatcagaagttttaaaggccacgtgaggaagatgctgcggcatgcggaagcatcagccatcgtggagtacgcatacaatgacaaagccattttggagcagaggaacatgctgacggaagagctctatgggaacacatttcagctttacaagtcagcagatcacccaactctggacaaagtgttagagttacagccagaaaaattagaacttattatggatgaaatgaaacagattctaactccaatggcccaaaaggaagctgtgattaagcactcattggtgcataaagtattcttggacttttttacctatgcaccccccaaactcagatcagaaatgattgaagccatccgcgaagcggtggtctacctggcacacacacacgatggcgccagagtggccatgcactgcctgtggcatggcacgcccaaggacaggaaagtgattgtgaaaacaatgaagacttatgttgaaaaggtggctaatggccaatactcccatttggttttactggcggcatttgattgtattgatgatactaagcttgtgaagcagataatcatatcagaaattatcagttcattgcctagcatagtaaatgacaaatatggaaggaaggtcctattgtacttactaagccccagagatcctgcacatacagtacgagaaatcattgaagttctgcaaaaaggagatggaaatgcacacagtaagaaagatacagaggtccgcagacgggagctcctagaatccatttctccagctttgttaagctacctgcaagaacacgcccaagaagtggtgctagataagtctgcgtgtgtgttggtgtctgacattctgggatctgccactggagacgttcagcctaccatgaatgccatcgccagcttggcagcaacaggactgcatcctggtggcaaggacggagagcttcacattgcagaacatcctgcaggacatctagttctgaagtggttaatagagcaagataaaaagatgaaagaaaatgggagagaaggttgttttgcaaaaacacttgtagagcatgttggtatgaagaacctgaagtcctgggctagtgtaaatcgaggtgccattattctttctagcctcctccagagttgtgacctggaagttgcaaacaaagtcaaagctgcactgaaaagcttgattcctacattggaaaaaaccaaaagcaccagcaaaggaatagaaattctacttgaaaaactgagcacatag
Sequence Length
1947
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
73,584 Da
NCBI Official Full Name
Homo sapiens KIAA0020, mRNA
NCBI Official Synonym Full Names
pumilio RNA binding family member 3
NCBI Official Symbol
PUM3
NCBI Official Synonym Symbols
PEN; HA-8; PUF6; XTP5; PUF-A; HLA-HA8; KIAA0020
NCBI Protein Information
pumilio homolog 3
UniProt Protein Name
Pumilio homolog 3
UniProt Gene Name
PUM3
UniProt Synonym Gene Names
HLA-HA8
UniProt Entry Name
PUM3_HUMAN

Uniprot Description

PUM3: Inhibits the poly(ADP-ribosyl)ation activity of PARP1 and the degradation of PARP1 by CASP3 following genotoxic stress (PubMed:21266351). Binds to double-stranded RNA or DNA without sequence specificity (PubMed:25512524). Involved in development of the eye and of primordial germ cells. {ECO:0000250|UniProtKB:X1WGX5, ECO:0000269|PubMed:21266351, ECO:0000269|PubMed:25512524}. Interacts with PARP1 (via catalytic domain). {ECO:0000269|PubMed:21266351}

Protein type: RNA-binding; Nucleolus; Endoplasmic reticulum

Chromosomal Location of Human Ortholog: 9p24.2

Cellular Component: chromosome; endoplasmic reticulum; nucleolus; nucleoplasm

Molecular Function: mRNA binding; protein binding

Biological Process: regulation of translation

Research Articles on KIAA0020

Similar Products

Product Notes

The KIAA0020 pum3 (Catalog #AAA1276722) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaagtta aagggaaaaa gcaattcaca ggaaagaata caaagacagc acaagaaaaa aacagatttc ataaaaatag tgattctggt tcttcaaaga catttccaac aaggaaagtt gctaaagaag gtggacctaa agtcacatct aggaactttg agaaaagtat cacaaaactt gggaaaaagg gtgtaaagca gttcaagaat aagcagcaag gggacaaatc accaaagaac aaattccagc cggcaaataa attcaacaag aagagaaaat tccagccaga tggtagaagc gatgaatcag cagccaagaa gcccaaatgg gatgacttca aaaagaagaa gaaagaactg aagcaaagca gacaactcag tgataaaacc aactatgaca ttgttgttcg ggcaaagcag atgtgggaga ttttaagaag aaaagactgt gacaaagaaa aaagagtaaa gttaatgagt gatttgcaga agttgattca agggaaaatt aaaactattg catttgcaca cgattcaact cgtgtgatcc agtgttacat tcagtatggt aatgaagaac agagaaaaca ggcttttgaa gaattgcgag atgatttggt tgagttaagt aaagccaaat attcgagaaa tattgttaag aaatttctca tgtatggaag taaaccacag attgcagaga taatcagaag ttttaaaggc cacgtgagga agatgctgcg gcatgcggaa gcatcagcca tcgtggagta cgcatacaat gacaaagcca ttttggagca gaggaacatg ctgacggaag agctctatgg gaacacattt cagctttaca agtcagcaga tcacccaact ctggacaaag tgttagagtt acagccagaa aaattagaac ttattatgga tgaaatgaaa cagattctaa ctccaatggc ccaaaaggaa gctgtgatta agcactcatt ggtgcataaa gtattcttgg acttttttac ctatgcaccc cccaaactca gatcagaaat gattgaagcc atccgcgaag cggtggtcta cctggcacac acacacgatg gcgccagagt ggccatgcac tgcctgtggc atggcacgcc caaggacagg aaagtgattg tgaaaacaat gaagacttat gttgaaaagg tggctaatgg ccaatactcc catttggttt tactggcggc atttgattgt attgatgata ctaagcttgt gaagcagata atcatatcag aaattatcag ttcattgcct agcatagtaa atgacaaata tggaaggaag gtcctattgt acttactaag ccccagagat cctgcacata cagtacgaga aatcattgaa gttctgcaaa aaggagatgg aaatgcacac agtaagaaag atacagaggt ccgcagacgg gagctcctag aatccatttc tccagctttg ttaagctacc tgcaagaaca cgcccaagaa gtggtgctag ataagtctgc gtgtgtgttg gtgtctgaca ttctgggatc tgccactgga gacgttcagc ctaccatgaa tgccatcgcc agcttggcag caacaggact gcatcctggt ggcaaggacg gagagcttca cattgcagaa catcctgcag gacatctagt tctgaagtgg ttaatagagc aagataaaaa gatgaaagaa aatgggagag aaggttgttt tgcaaaaaca cttgtagagc atgttggtat gaagaacctg aagtcctggg ctagtgtaaa tcgaggtgcc attattcttt ctagcctcct ccagagttgt gacctggaag ttgcaaacaa agtcaaagct gcactgaaaa gcttgattcc tacattggaa aaaaccaaaa gcaccagcaa aggaatagaa attctacttg aaaaactgag cacatag. It is sometimes possible for the material contained within the vial of "KIAA0020, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.