Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

KDELR2 cdna clone

KDELR2 cDNA Clone

Gene Names
KDELR2; ELP-1; ERD2.2
Synonyms
KDELR2; KDELR2 cDNA Clone; KDELR2 cdna clone
Ordering
For Research Use Only!
Sequence
atgaacattttccggctgactggggacctgtcccacctggcggccatcgtcatcctgctgctgaagatctggaagacgcgctcctgcgccggtatttctgggaaaagccagcttctgtttgcactggtcttcacaactcgttacctggatctttttacttcatttatttcattgtataacacatctatgaaggttatctaccttgcctgctcctatgccacagtgtacctgatctacctgaaatttaaggcaacctacgatggaaatcatgataccttccgagtggagtttctggtggtccctgtgggaggcctctcatttttagttaatcacgatttctctcctcttgagtactcaagggaaagaagctcagtttgccagcataagtgccaaagaccatcaccagcatctgtccttcagggtgctcggacagaattcttaccacagcaaaggcataagatgcttgatacggaaaatcagaaacttaactcttttgttgcagatagtcatcagtggctctgtaaaaacgcagaggaaaagagccagaaggtttctgtttaa
Sequence Length
561
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
21,242 Da
NCBI Official Full Name
Homo sapiens KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 2, mRNA
NCBI Official Synonym Full Names
KDEL endoplasmic reticulum protein retention receptor 2
NCBI Official Symbol
KDELR2
NCBI Official Synonym Symbols
ELP-1; ERD2.2
NCBI Protein Information
ER lumen protein-retaining receptor 2
UniProt Protein Name
ER lumen protein-retaining receptor 2
UniProt Gene Name
KDELR2
UniProt Synonym Gene Names
ERD2.2; ELP-1; KDEL receptor 2
UniProt Entry Name
ERD22_HUMAN

NCBI Description

Retention of resident soluble proteins in the lumen of the endoplasmic reticulum (ER) is achieved in both yeast and animal cells by their continual retrieval from the cis-Golgi, or a pre-Golgi compartment. Sorting of these proteins is dependent on a C-terminal tetrapeptide signal, usually lys-asp-glu-leu (KDEL) in animal cells, and his-asp-glu-leu (HDEL) in S. cerevisiae. This process is mediated by a receptor that recognizes, and binds the tetrapeptide-containing protein, and returns it to the ER. In yeast, the sorting receptor encoded by a single gene, ERD2, is a seven-transmembrane protein. Unlike yeast, several human homologs of the ERD2 gene, constituting the KDEL receptor gene family, have been described. KDELR2 was the second member of the family to be identified, and it encodes a protein which is 83% identical to the KDELR1 gene product. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]

Uniprot Description

KDELR2: Required for the retention of luminal endoplasmic reticulum proteins. Determines the specificity of the luminal ER protein retention system. Also required for normal vesicular traffic through the Golgi. This receptor recognizes K-D-E-L. Belongs to the ERD2 family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, integral; Membrane protein, multi-pass

Chromosomal Location of Human Ortholog: 7p22.1

Cellular Component: endoplasmic reticulum; endoplasmic reticulum membrane; Golgi apparatus; Golgi membrane; transport vesicle

Molecular Function: KDEL sequence binding

Biological Process: intracellular protein transport; retrograde vesicle-mediated transport, Golgi to ER

Research Articles on KDELR2

Similar Products

Product Notes

The KDELR2 kdelr2 (Catalog #AAA1276528) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaacattt tccggctgac tggggacctg tcccacctgg cggccatcgt catcctgctg ctgaagatct ggaagacgcg ctcctgcgcc ggtatttctg ggaaaagcca gcttctgttt gcactggtct tcacaactcg ttacctggat ctttttactt catttatttc attgtataac acatctatga aggttatcta ccttgcctgc tcctatgcca cagtgtacct gatctacctg aaatttaagg caacctacga tggaaatcat gataccttcc gagtggagtt tctggtggtc cctgtgggag gcctctcatt tttagttaat cacgatttct ctcctcttga gtactcaagg gaaagaagct cagtttgcca gcataagtgc caaagaccat caccagcatc tgtccttcag ggtgctcgga cagaattctt accacagcaa aggcataaga tgcttgatac ggaaaatcag aaacttaact cttttgttgc agatagtcat cagtggctct gtaaaaacgc agaggaaaag agccagaagg tttctgttta a. It is sometimes possible for the material contained within the vial of "KDELR2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.