Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

KCNJ5 cdna clone

KCNJ5 cDNA Clone

Gene Names
KCNJ5; CIR; GIRK4; KATP1; LQT13; KIR3.4
Synonyms
KCNJ5; KCNJ5 cDNA Clone; KCNJ5 cdna clone
Ordering
For Research Use Only!
Sequence
atggctggcgattctaggaatgccatgaaccaggacatggagattggagtcactccctgggaccccaagaagattccaaaacaggcccgcgattatgtccccattgccacagaccgtacgcgcctgctggccgagggcaagaagccacgccagcgctacatggagaagagcggcaagtgcaacgtgcaccacggcaacgtccaggagacctaccggtacctgagtgacctcttcaccaccctggtggacctcaagtggcgcttcaacttgctcgtcttcaccatggtttacactgtcacctggctgttcttcggcttcatttggtggctcattgcttatatccggggtgacctggaccatgttggcgaccaagagtggattccttgtgttgaaaacctcagtggcttcgtgtccgctttcctgttctccattgagaccgaaacaaccattgggtatggcttccgagtcatcacagagaagtgtccagaggggattatactcctcttggtccaggccatcctgggctccatcgtcaatgccttcatggtggggtgcatgtttgtcaagatcagccagcccaagaagagagcggagaccctcatgttttccaacaacgcagtcatctccatgcgggacgagaagctgtgcctcatgttccgggtgggcgacctccgcaactcccacatcgtggaggcctccatccgggccaagctcatcaagtcccggcagaccaaagagggggagttcatccccctgaaccagacagacatcaacgtgggctttgacacgggcgacgaccgcctcttcctggtgtctcctctgatcatctcccacgagatcaacgagaagagccctttctgggagatgtctcaggctcagctgcatcaggaagagtttgaagttgtggtcattctagaagggatggtggaagccacaggcatgacctgccaagcccggagctcctacatggatacagaggtgctctggggccaccgattcacaccagtcctcaccttggaaaagggcttctatgaggtggactacaacaccttccatgatacctatgagaccaacacacccagctgctgtgccaaggagctggcagaaatgaagagggaaggccggctcctccagtacctccccagccccccactgctggggggctgtgctgaggcagggctggatgcagaggctgagcagaatgaagaagatgagcccaaggggctgggtgggtccagggaggccaggggctcggtgtga
Sequence Length
1260
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
47,668 Da
NCBI Official Full Name
Homo sapiens potassium inwardly-rectifying channel, subfamily J, member 5, mRNA
NCBI Official Synonym Full Names
potassium voltage-gated channel subfamily J member 5
NCBI Official Symbol
KCNJ5
NCBI Official Synonym Symbols
CIR; GIRK4; KATP1; LQT13; KIR3.4
NCBI Protein Information
G protein-activated inward rectifier potassium channel 4
UniProt Protein Name
G protein-activated inward rectifier potassium channel 4
UniProt Gene Name
KCNJ5
UniProt Synonym Gene Names
GIRK4; GIRK-4; CIR; IRK-4
UniProt Entry Name
KCNJ5_HUMAN

NCBI Description

Potassium channels are present in most mammalian cells, where they participate in a wide range of physiologic responses. The protein encoded by this gene is an integral membrane protein and inward-rectifier type potassium channel. The encoded protein, which has a greater tendency to allow potassium to flow into a cell rather than out of a cell, is controlled by G-proteins. It may associate with two other G-protein-activated potassium channels to form a heteromultimeric pore-forming complex. [provided by RefSeq, Jul 2008]

Uniprot Description

GIRK4: This potassium channel is controlled by G proteins. Inward rectifier potassium channels are characterized by a greater tendency to allow potassium to flow into the cell rather than out of it. Their voltage dependence is regulated by the concentration of extracellular potassium; as external potassium is raised, the voltage range of the channel opening shifts to more positive voltages. The inward rectification is mainly due to the blockage of outward current by internal magnesium. Can be blocked by external barium. Defects in KCNJ5 are the cause of long QT syndrome type 13 (LQT13). It is a heart disorder characterized by a prolonged QT interval on the ECG and polymorphic ventricular arrhythmias. They cause syncope and sudden death in response to excercise or emotional stress, and can present with a sentinel event of sudden cardiac death in infancy. Defects in KCNJ5 are the cause of familial hyperaldosteronism type 3 (FH3). A form of hyperaldosteronism characterized by hypertension secondary to massive adrenal mineralocorticoid production. Like patients with familial hyperaldosteronism type 1 (glucocorticoid-remediable aldosteronism), patients with FH3 present with childhood hypertension, elevated aldosteronism levels, and high levels of the hybrid steroids 18-oxocortisol and 18-hydroxycortisol. However, hypertension and aldosteronism are not reversed by administration of exogenous glucocorticoids and patients require adrenalectomy to control hypertension. Somatic mutations in KCNJ5 have been found in aldosterone-producing adrenal adenomas and can be responsible for aldosteronism associated with cell autonomous proliferation. These are typically solitary, well circumscribed tumors diagnosed between ages 30 and 70. They come to medical attention due to new or worsening hypertension, often with hypokalemia. KCNJ5 mutations produce increased sodium conductance and cell depolarization, which in adrenal glomerulosa cells produces calcium entry, the signal for aldosterone production and cell proliferation. Belongs to the inward rectifier-type potassium channel (TC 1.A.2.1) family. KCNJ5 subfamily.

Protein type: Membrane protein, integral; Membrane protein, multi-pass; Channel, potassium

Chromosomal Location of Human Ortholog: 11q24

Cellular Component: plasma membrane; voltage-gated potassium channel complex

Molecular Function: G-protein activated inward rectifier potassium channel activity; inward rectifier potassium channel activity; protein binding

Biological Process: potassium ion import; potassium ion transport

Disease: Hyperaldosteronism, Familial, Type Iii; Long Qt Syndrome 13

Research Articles on KCNJ5

Similar Products

Product Notes

The KCNJ5 kcnj5 (Catalog #AAA1269474) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctggcg attctaggaa tgccatgaac caggacatgg agattggagt cactccctgg gaccccaaga agattccaaa acaggcccgc gattatgtcc ccattgccac agaccgtacg cgcctgctgg ccgagggcaa gaagccacgc cagcgctaca tggagaagag cggcaagtgc aacgtgcacc acggcaacgt ccaggagacc taccggtacc tgagtgacct cttcaccacc ctggtggacc tcaagtggcg cttcaacttg ctcgtcttca ccatggttta cactgtcacc tggctgttct tcggcttcat ttggtggctc attgcttata tccggggtga cctggaccat gttggcgacc aagagtggat tccttgtgtt gaaaacctca gtggcttcgt gtccgctttc ctgttctcca ttgagaccga aacaaccatt gggtatggct tccgagtcat cacagagaag tgtccagagg ggattatact cctcttggtc caggccatcc tgggctccat cgtcaatgcc ttcatggtgg ggtgcatgtt tgtcaagatc agccagccca agaagagagc ggagaccctc atgttttcca acaacgcagt catctccatg cgggacgaga agctgtgcct catgttccgg gtgggcgacc tccgcaactc ccacatcgtg gaggcctcca tccgggccaa gctcatcaag tcccggcaga ccaaagaggg ggagttcatc cccctgaacc agacagacat caacgtgggc tttgacacgg gcgacgaccg cctcttcctg gtgtctcctc tgatcatctc ccacgagatc aacgagaaga gccctttctg ggagatgtct caggctcagc tgcatcagga agagtttgaa gttgtggtca ttctagaagg gatggtggaa gccacaggca tgacctgcca agcccggagc tcctacatgg atacagaggt gctctggggc caccgattca caccagtcct caccttggaa aagggcttct atgaggtgga ctacaacacc ttccatgata cctatgagac caacacaccc agctgctgtg ccaaggagct ggcagaaatg aagagggaag gccggctcct ccagtacctc cccagccccc cactgctggg gggctgtgct gaggcagggc tggatgcaga ggctgagcag aatgaagaag atgagcccaa ggggctgggt gggtccaggg aggccagggg ctcggtgtga. It is sometimes possible for the material contained within the vial of "KCNJ5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.