Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

KCNJ4 cdna clone

KCNJ4 cDNA Clone

Gene Names
KCNJ4; HIR; HRK1; IRK3; HIRK2; IRK-3; Kir2.3
Synonyms
KCNJ4; KCNJ4 cDNA Clone; KCNJ4 cdna clone
Ordering
For Research Use Only!
Sequence
atgcacggacacagccgcaacggccaggcccacgtgccccggcggaagcgccgcaaccgcttcgtcaagaagaacggccaatgcaacgtgtacttcgccaacctgagcaacaagtcgcagcgctacatggcggacatcttcaccacctgcgtggacacgcgctggcgctacatgctcatgatcttctccgcggccttccttgtctcctggctctttttcggcctcctcttctggtgtatcgccttcttccacggtgacctggaggccagcccaggggtgcctgcggcggggggcccggcggcgggtggtggcggagcagccccggtggcccccaagccctgcatcatgcacgtgaacggcttcctgggtgccttcctgttctcggtggagacgcagacgaccatcggctatgggttccggtgcgtgacagaggagtgcccgctggcagtcatcgctgtggtggtccagtccatcgtgggctgcgtcatcgactccttcatgattggcaccatcatggccaagatggcgcggcccaagaagcgggcgcagacgttgctgttcagccaccacgcggtcatttcggtgcgcgacggcaagctctgcctcatgtggcgcgtgggcaacctgcgcaagagccacattgtggaggcccacgtgcgggcccagctcatcaagccctacatgacccaggagggcgagtacctgcccctggaccagcgggacctcaacgtgggctatgacatcggcctggaccgcatcttcctggtgtcgcccatcatcattgtccacgagatcgacgaggacagcccgctttatggcatgggcaaggaggagctggagtcggaggactttgagatcgtggtcatcctggagggcatggtggaggccacggccatgaccacccaggcccgcagctcctacctggccagcgagatcctgtggggccaccgctttgagcctgtggtcttcgaggagaagagccactacaaggtggactactcgcgttttcacaagacctacgaggtggccggcacgccctgctgctcggcccgggagctgcaggagagtaagatcaccgtgctgcccgccccaccgccccctcccagtgccttctgctacgagaacgagctggcccttatgagccaggaggaagaggagatggaggaggaggcagctgcggcggccgcggtggccgcaggcctgggcctggaggcgggttccaaggaggaggcgggcatcatccggatgctggagttcggcagccacctggacctggagcgcatgcaggcttccctcccgctggacaacatctcctaccgcagggagtctgccatctga
Sequence Length
1338
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
49,500 Da
NCBI Official Full Name
Homo sapiens potassium inwardly-rectifying channel, subfamily J, member 4, mRNA
NCBI Official Synonym Full Names
potassium voltage-gated channel subfamily J member 4
NCBI Official Symbol
KCNJ4
NCBI Official Synonym Symbols
HIR; HRK1; IRK3; HIRK2; IRK-3; Kir2.3
NCBI Protein Information
inward rectifier potassium channel 4
UniProt Protein Name
Inward rectifier potassium channel 4
UniProt Gene Name
KCNJ4
UniProt Synonym Gene Names
IRK3; HIR; IRK-3
UniProt Entry Name
KCNJ4_HUMAN

NCBI Description

Several different potassium channels are known to be involved with electrical signaling in the nervous system. One class is activated by depolarization whereas a second class is not. The latter are referred to as inwardly rectifying K+ channels, and they have a greater tendency to allow potassium to flow into the cell rather than out of it. This asymmetry in potassium ion conductance plays a key role in the excitability of muscle cells and neurons. The protein encoded by this gene is an integral membrane protein and member of the inward rectifier potassium channel family. The encoded protein has a small unitary conductance compared to other members of this protein family. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

HIR: This receptor is controlled by G proteins. Inward rectifier potassium channels are characterized by a greater tendency to allow potassium to flow into the cell rather than out of it. Their voltage dependence is regulated by the concentration of extracellular potassium; as external potassium is raised, the voltage range of the channel opening shifts to more positive voltages. The inward rectification is mainly due to the blockage of outward current by internal magnesium. Can be blocked by extracellular barium and cesium. Belongs to the inward rectifier-type potassium channel (TC 1.A.2.1) family. KCNJ4 subfamily.

Protein type: Channel, potassium; Membrane protein, integral; Membrane protein, multi-pass

Chromosomal Location of Human Ortholog: 22q13.1

Cellular Component: basolateral plasma membrane; plasma membrane; voltage-gated potassium channel complex

Molecular Function: G-protein activated inward rectifier potassium channel activity; inward rectifier potassium channel activity; PDZ domain binding; protein binding

Biological Process: potassium ion import; potassium ion transport

Research Articles on KCNJ4

Similar Products

Product Notes

The KCNJ4 kcnj4 (Catalog #AAA1277989) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcacggac acagccgcaa cggccaggcc cacgtgcccc ggcggaagcg ccgcaaccgc ttcgtcaaga agaacggcca atgcaacgtg tacttcgcca acctgagcaa caagtcgcag cgctacatgg cggacatctt caccacctgc gtggacacgc gctggcgcta catgctcatg atcttctccg cggccttcct tgtctcctgg ctctttttcg gcctcctctt ctggtgtatc gccttcttcc acggtgacct ggaggccagc ccaggggtgc ctgcggcggg gggcccggcg gcgggtggtg gcggagcagc cccggtggcc cccaagccct gcatcatgca cgtgaacggc ttcctgggtg ccttcctgtt ctcggtggag acgcagacga ccatcggcta tgggttccgg tgcgtgacag aggagtgccc gctggcagtc atcgctgtgg tggtccagtc catcgtgggc tgcgtcatcg actccttcat gattggcacc atcatggcca agatggcgcg gcccaagaag cgggcgcaga cgttgctgtt cagccaccac gcggtcattt cggtgcgcga cggcaagctc tgcctcatgt ggcgcgtggg caacctgcgc aagagccaca ttgtggaggc ccacgtgcgg gcccagctca tcaagcccta catgacccag gagggcgagt acctgcccct ggaccagcgg gacctcaacg tgggctatga catcggcctg gaccgcatct tcctggtgtc gcccatcatc attgtccacg agatcgacga ggacagcccg ctttatggca tgggcaagga ggagctggag tcggaggact ttgagatcgt ggtcatcctg gagggcatgg tggaggccac ggccatgacc acccaggccc gcagctccta cctggccagc gagatcctgt ggggccaccg ctttgagcct gtggtcttcg aggagaagag ccactacaag gtggactact cgcgttttca caagacctac gaggtggccg gcacgccctg ctgctcggcc cgggagctgc aggagagtaa gatcaccgtg ctgcccgccc caccgccccc tcccagtgcc ttctgctacg agaacgagct ggcccttatg agccaggagg aagaggagat ggaggaggag gcagctgcgg cggccgcggt ggccgcaggc ctgggcctgg aggcgggttc caaggaggag gcgggcatca tccggatgct ggagttcggc agccacctgg acctggagcg catgcaggct tccctcccgc tggacaacat ctcctaccgc agggagtctg ccatctga. It is sometimes possible for the material contained within the vial of "KCNJ4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.