KCNH7 cdna clone
KCNH7 cDNA Clone
Gene Names
KCNH7; ERG3; HERG3; Kv11.3
Synonyms
KCNH7; KCNH7 cDNA Clone; KCNH7 cdna clone
Sequence
atgcctgtgcgcagggggcatgtggcaccacaaaatacatttctggggaccatcattcggaaatttgaagggcaaaataaaaaatttatcattgcaaatgccagagtgcagaactgtgccatcatttattgcaacgatgggttctgtgagatgactggtttctccaggccagatgtcatgcaaaagccatgcacctgcgactttctccatggacccgagaccaagaggcatgatattgcccaaattgcccaggcattgctggggtcagaagagaggaaagtggaggtcacctactatcacaaaaatgggtccacttttatttgtaacactcacataattccagtgaaaaaccaagagggcgtggctatgatgttcatcattaattttgaatatgtgacggataatgaaaacgctgccaccccagagagggtaaacccaatattaccaatcaaaactgtaaaccggaaattttttgggttcaaattccctggtctgagagttctcacttacagaaagcagtccttaccacaagaagaccccgatgtggtggtcatcgattcatctaaacacagtgatgattcagtagccatgaagcattttaagtctcctacaaaagaaagctgcagcccctctgaagcagatgacacaaaagctttgatacagcccagcaaatgttctcccttggtgaatatatccggacctcttgaccattcctctcccaaaaggcaatgggaccgactctaccctgacatgctgcagtcaagttcccagctgtcccattccagatcaagggaaagcttatgtagtatacggagagcatcttcggtccatgatatagaaggattcggcgtccaccccaagaacatatttagagaccgacatgccagcgaagggccttttaatcatatcaagtcaagcctcctgggatccacatcagattcaaacctcaacaaatacagcaccattaacaagattccacagctcactctgaatttttcagaggtcaaaactgagaaaaagaattcatcacctccttcttcagataaaaccattattgcacccaaggttaaagatcgaacacacaatgtgactgagaaagtgacccaggttctctctttaggagcagatgtcctacctgaatacaaactgcagacaccacgcatcaacaagtttacgatattgcactacagccctttcaaggcagtctgggactggcttatcctgctgttggtcatatacactgctatatttactccctactctgcagccttcctcctcaatgacagagaagaacagaaaagacgagaatgtggctattcttgtagccctttgaatgtggtagacttgattgtggatattatgtttatcatagatattttaataaacttcagaacaacatatgtaaatcagaatgaagaagtggtaagtgatcccgccaaaatagcaatacactacttcaaaggctggttcctgattgacatggttgcagcaattccttttgacttgctgatttttggatcaggttctgatgagacaacaacattaattggtcttttgaagactgcccgactcctccgtcttgtgcgcgtggccaggaaactggatcgatattcagaatatggcgctgctgttctaatgctcttaatgtgcatctttgccctgattgctcactggctggcttgcatttggtatgcgattgggaatgtagaaaggccttacctgactgacaaaatcggatggttggattccttaggacagcaaattgggaaacgttacaatgacagtgactcaagttctggaccatccattaaagacaaatacgtcacagcactttattttaccttcagcagtttaaccagtgtaggattcgggaatgtgtctcctaacacgaattcggagaaaatcttttcaatttgtgtcatgttgattggctcactaatgtatgcaagcatttttgggaatgtatctgcaattatccaaagactatactcgggaactgccaggtaccacatgcagatgctgcgagtaaaagagttcattcgctttcaccaaatccccaaccctctgaggcaacgtcttgaagaatatttccagcacgcatggacttacaccaatggcattgacatgaacatggtatgtatgtctgttttccaaaatgaaagtgccgcaggcattatagtgatagccaaaatggaataa
Sequence Length
2199
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
82,904 Da
NCBI Official Full Name
Homo sapiens potassium voltage-gated channel, subfamily H (eag-related), member 7, mRNA
NCBI Official Synonym Full Names
potassium voltage-gated channel subfamily H member 7
NCBI Official Symbol
KCNH7
NCBI Official Synonym Symbols
ERG3; HERG3; Kv11.3
NCBI Protein Information
potassium voltage-gated channel subfamily H member 7
UniProt Protein Name
Potassium voltage-gated channel subfamily H member 7
Protein Family
UniProt Gene Name
KCNH7
UniProt Synonym Gene Names
ERG3; ERG-3; Eag-related protein 3; Ether-a-go-go-related protein 3; hERG-3
UniProt Entry Name
KCNH7_HUMAN
NCBI Description
Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily H. This member is a pore-forming (alpha) subunit. There are at least two alternatively spliced transcript variants derived from this gene and encoding distinct isoforms. [provided by RefSeq, Jul 2008]
Uniprot Description
Kv11.3: Pore-forming (alpha) subunit of voltage-gated potassium channel. Channel properties may be modulated by cAMP and subunit assembly. Belongs to the potassium channel family. H (Eag) (TC 1.A.1.20) subfamily. Kv11.3/KCNH7 sub-subfamily. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Channel, potassium; Membrane protein, integral; Membrane protein, multi-pass
Chromosomal Location of Human Ortholog: 2q24.2
Cellular Component: integral to plasma membrane; plasma membrane
Molecular Function: voltage-gated potassium channel activity
Biological Process: regulation of membrane potential
Research Articles on KCNH7
Similar Products
Product Notes
The KCNH7 kcnh7 (Catalog #AAA1275164) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcctgtgc gcagggggca tgtggcacca caaaatacat ttctggggac catcattcgg aaatttgaag ggcaaaataa aaaatttatc attgcaaatg ccagagtgca gaactgtgcc atcatttatt gcaacgatgg gttctgtgag atgactggtt tctccaggcc agatgtcatg caaaagccat gcacctgcga ctttctccat ggacccgaga ccaagaggca tgatattgcc caaattgccc aggcattgct ggggtcagaa gagaggaaag tggaggtcac ctactatcac aaaaatgggt ccacttttat ttgtaacact cacataattc cagtgaaaaa ccaagagggc gtggctatga tgttcatcat taattttgaa tatgtgacgg ataatgaaaa cgctgccacc ccagagaggg taaacccaat attaccaatc aaaactgtaa accggaaatt ttttgggttc aaattccctg gtctgagagt tctcacttac agaaagcagt ccttaccaca agaagacccc gatgtggtgg tcatcgattc atctaaacac agtgatgatt cagtagccat gaagcatttt aagtctccta caaaagaaag ctgcagcccc tctgaagcag atgacacaaa agctttgata cagcccagca aatgttctcc cttggtgaat atatccggac ctcttgacca ttcctctccc aaaaggcaat gggaccgact ctaccctgac atgctgcagt caagttccca gctgtcccat tccagatcaa gggaaagctt atgtagtata cggagagcat cttcggtcca tgatatagaa ggattcggcg tccaccccaa gaacatattt agagaccgac atgccagcga agggcctttt aatcatatca agtcaagcct cctgggatcc acatcagatt caaacctcaa caaatacagc accattaaca agattccaca gctcactctg aatttttcag aggtcaaaac tgagaaaaag aattcatcac ctccttcttc agataaaacc attattgcac ccaaggttaa agatcgaaca cacaatgtga ctgagaaagt gacccaggtt ctctctttag gagcagatgt cctacctgaa tacaaactgc agacaccacg catcaacaag tttacgatat tgcactacag ccctttcaag gcagtctggg actggcttat cctgctgttg gtcatataca ctgctatatt tactccctac tctgcagcct tcctcctcaa tgacagagaa gaacagaaaa gacgagaatg tggctattct tgtagccctt tgaatgtggt agacttgatt gtggatatta tgtttatcat agatatttta ataaacttca gaacaacata tgtaaatcag aatgaagaag tggtaagtga tcccgccaaa atagcaatac actacttcaa aggctggttc ctgattgaca tggttgcagc aattcctttt gacttgctga tttttggatc aggttctgat gagacaacaa cattaattgg tcttttgaag actgcccgac tcctccgtct tgtgcgcgtg gccaggaaac tggatcgata ttcagaatat ggcgctgctg ttctaatgct cttaatgtgc atctttgccc tgattgctca ctggctggct tgcatttggt atgcgattgg gaatgtagaa aggccttacc tgactgacaa aatcggatgg ttggattcct taggacagca aattgggaaa cgttacaatg acagtgactc aagttctgga ccatccatta aagacaaata cgtcacagca ctttatttta ccttcagcag tttaaccagt gtaggattcg ggaatgtgtc tcctaacacg aattcggaga aaatcttttc aatttgtgtc atgttgattg gctcactaat gtatgcaagc atttttggga atgtatctgc aattatccaa agactatact cgggaactgc caggtaccac atgcagatgc tgcgagtaaa agagttcatt cgctttcacc aaatccccaa ccctctgagg caacgtcttg aagaatattt ccagcacgca tggacttaca ccaatggcat tgacatgaac atggtatgta tgtctgtttt ccaaaatgaa agtgccgcag gcattatagt gatagccaaa atggaataa. It is sometimes possible for the material contained within the vial of "KCNH7, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
