Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

KATNB1 cdna clone

KATNB1 cDNA Clone

Gene Names
KATNB1; KAT; LIS6
Synonyms
KATNB1; KATNB1 cDNA Clone; KATNB1 cdna clone
Ordering
For Research Use Only!
Sequence
atggccacccctgtggtcaccaagacagcctggaagttgcaagagatcgtcgcgcatgccagcaacgtgtcctcactggtgctgggcaaagcctccgggcggctgctggctacaggcggggatgactgccgcgtcaacctgtggtccatcaacaagcccaactgcatcatgagcctgacgggccacacatccccagtggagagcgtccgcctcaacacccccgaggagctcatcgtggccggctctcagtcgggctccatccgtgtctgggacctggaagctgccaaaattcttcgcacactcatgggacacaaagccaacatctgcagcctggatttccacccgtacggcgagtttgtagcctctggttcccaggacacaaacatcaagctctgggacatcaggaggaaaggctgtgtcttccgatacagggggcacagccaggccgtgcggtgtctccggttcagccccgatgggaagtggttggcgtcggccgcagatgaccacaccgtgaagctctgggatctcactgccggcaagatgatgtctgagttccctggtcacacggggcctgtcaacgtggtcgagtttcaccccaacgagtacctcctggcctccggcagctctgacaggacaatccgcttctgggacctggagaagttccaggtggtgagctgcatcgaaggggagcctgggcccgtcaggagcgtcctcttcaacccagatggctgctgcctgtacagcggctgccaggactcactgcgtgtctacggctgggaacctgagcggtgctttgatgtggtcctcgtcaactggggcaaggtggccgacctggccatctgcaatgaccagttgataggtgtggccttctcccagagcaacgtctcctcctacgtggtggatctgacgcgtgtcaccaggactggcacggtggcccgggaccctgtgcaggaccaccggcccctggcacagccactgcccaaccccagcgcccccctccggcgcatctatgagcggcccagcacaacctgcagcaagcctcagagggtgaagcagaactcagagagcgagcgccgcagccccagcagcgaggatgaccgggacgagcgcgagtcccgcgcggagatccagaacgccgaggactacaacgagatcttccagcccaagaacagcatcagtcggacgccaccccggagaagtgagcccttccctgcacccccagaggacgacgcagccacagcaaaggaggcagcaaagcccagccctgccatggatgtgcagttcccggtgccaaatctggaggtcctgccccggcccccagtggttgcttccacacctgcacccaaggctgagcctgccatcatccctgccacccggaacgagcccatcgggctgaaggcctccgacttcctgcccgccgtgaagatcccccagcaggccgagctggtggacgaggatgccatgtcacagatccgcaaaggccacgacaccatgtgtgtggtgctcaccagccgccacaagaacctggacactgtgcgggctgtgtggaccatgggcgacatcaagacgtcggtggactccgctgtggccatcaacgacctgtcggtggtggtggacctcctgaacatcgtcaaccagaaagcctccctgtggaagctggacctgtgcaccaccgtcctgccacagattgagaagcttctgcagagcaagtatgagagctacgtccagacgggctgcacctccctgaagctgatcctgcagcggtttctgcccctcatcacagacatgctggcggccccaccctctgtgggtgtggatatcagcagggaggagaggctgcataagtgccggctctgctacaagcagcttaagagcatcagcggcctggtcaagagcaagtcaggcctgagcggccgccatggcagtaccttccgcgagctgcacctgctcatggccagtctggactga
Sequence Length
1968
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
72,334 Da
NCBI Official Full Name
Homo sapiens katanin p80 (WD repeat containing) subunit B 1, mRNA
NCBI Official Synonym Full Names
katanin regulatory subunit B1
NCBI Official Symbol
KATNB1
NCBI Official Synonym Symbols
KAT; LIS6
NCBI Protein Information
katanin p80 WD40 repeat-containing subunit B1
UniProt Protein Name
Katanin p80 WD40 repeat-containing subunit B1
Protein Family
UniProt Gene Name
KATNB1
UniProt Synonym Gene Names
Katanin p80 subunit B1
UniProt Entry Name
KTNB1_HUMAN

NCBI Description

Microtubules, polymers of alpha and beta tubulin subunits, form the mitotic spindle of a dividing cell and help to organize membranous organelles during interphase. Katanin is a heterodimer that consists of a 60 kDa ATPase (p60 subunit A 1) and an 80 kDa accessory protein (p80 subunit B 1). The p60 subunit acts to sever and disassemble microtubules, while the p80 subunit targets the enzyme to the centrosome. Katanin is a member of the AAA family of ATPases. [provided by RefSeq, Jul 2008]

Uniprot Description

KATNB1: Participates in a complex which severs microtubules in an ATP-dependent manner. May act to target the enzymatic subunit of this complex to sites of action such as the centrosome. Microtubule severing may promote rapid reorganization of cellular microtubule arrays and the release of microtubules from the centrosome following nucleation. Microtubule release from the mitotic spindle poles may allow depolymerization of the microtubule end proximal to the spindle pole, leading to poleward microtubule flux and poleward motion of chromosome. Microtubule release within the cell body of neurons may be required for their transport into neuronal processes by microtubule-dependent motor proteins. This transport is required for axonal growth. Belongs to the WD repeat KATNB1 family.

Protein type: Cytoskeletal; Motility/polarity/chemotaxis

Chromosomal Location of Human Ortholog: 16q21

Cellular Component: cytoplasm; katanin complex; membrane; microtubule cytoskeleton; nucleus; plasma membrane; spindle pole

Molecular Function: microtubule-severing ATPase activity; protein heterodimerization activity

Biological Process: negative regulation of microtubule depolymerization; positive regulation of microtubule depolymerization

Disease: Lissencephaly 6, With Microcephaly

Research Articles on KATNB1

Similar Products

Product Notes

The KATNB1 katnb1 (Catalog #AAA1271027) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccaccc ctgtggtcac caagacagcc tggaagttgc aagagatcgt cgcgcatgcc agcaacgtgt cctcactggt gctgggcaaa gcctccgggc ggctgctggc tacaggcggg gatgactgcc gcgtcaacct gtggtccatc aacaagccca actgcatcat gagcctgacg ggccacacat ccccagtgga gagcgtccgc ctcaacaccc ccgaggagct catcgtggcc ggctctcagt cgggctccat ccgtgtctgg gacctggaag ctgccaaaat tcttcgcaca ctcatgggac acaaagccaa catctgcagc ctggatttcc acccgtacgg cgagtttgta gcctctggtt cccaggacac aaacatcaag ctctgggaca tcaggaggaa aggctgtgtc ttccgataca gggggcacag ccaggccgtg cggtgtctcc ggttcagccc cgatgggaag tggttggcgt cggccgcaga tgaccacacc gtgaagctct gggatctcac tgccggcaag atgatgtctg agttccctgg tcacacgggg cctgtcaacg tggtcgagtt tcaccccaac gagtacctcc tggcctccgg cagctctgac aggacaatcc gcttctggga cctggagaag ttccaggtgg tgagctgcat cgaaggggag cctgggcccg tcaggagcgt cctcttcaac ccagatggct gctgcctgta cagcggctgc caggactcac tgcgtgtcta cggctgggaa cctgagcggt gctttgatgt ggtcctcgtc aactggggca aggtggccga cctggccatc tgcaatgacc agttgatagg tgtggccttc tcccagagca acgtctcctc ctacgtggtg gatctgacgc gtgtcaccag gactggcacg gtggcccggg accctgtgca ggaccaccgg cccctggcac agccactgcc caaccccagc gcccccctcc ggcgcatcta tgagcggccc agcacaacct gcagcaagcc tcagagggtg aagcagaact cagagagcga gcgccgcagc cccagcagcg aggatgaccg ggacgagcgc gagtcccgcg cggagatcca gaacgccgag gactacaacg agatcttcca gcccaagaac agcatcagtc ggacgccacc ccggagaagt gagcccttcc ctgcaccccc agaggacgac gcagccacag caaaggaggc agcaaagccc agccctgcca tggatgtgca gttcccggtg ccaaatctgg aggtcctgcc ccggccccca gtggttgctt ccacacctgc acccaaggct gagcctgcca tcatccctgc cacccggaac gagcccatcg ggctgaaggc ctccgacttc ctgcccgccg tgaagatccc ccagcaggcc gagctggtgg acgaggatgc catgtcacag atccgcaaag gccacgacac catgtgtgtg gtgctcacca gccgccacaa gaacctggac actgtgcggg ctgtgtggac catgggcgac atcaagacgt cggtggactc cgctgtggcc atcaacgacc tgtcggtggt ggtggacctc ctgaacatcg tcaaccagaa agcctccctg tggaagctgg acctgtgcac caccgtcctg ccacagattg agaagcttct gcagagcaag tatgagagct acgtccagac gggctgcacc tccctgaagc tgatcctgca gcggtttctg cccctcatca cagacatgct ggcggcccca ccctctgtgg gtgtggatat cagcagggag gagaggctgc ataagtgccg gctctgctac aagcagctta agagcatcag cggcctggtc aagagcaagt caggcctgag cggccgccat ggcagtacct tccgcgagct gcacctgctc atggccagtc tggactga. It is sometimes possible for the material contained within the vial of "KATNB1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.