Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

KATNAL2 cdna clone

KATNAL2 cDNA Clone

Synonyms
KATNAL2; KATNAL2 cDNA Clone; KATNAL2 cdna clone
Ordering
For Research Use Only!
Sequence
atggaatatgagagttattattttgtaaaatttcagaaataccccaaaattgtcaaaaagtcatcagacacagcagaaaataatttaccgcaaagaagtagagggaagaccagaaggatgatgaacgacagttgtcaaaatcttcccaagatcaatcagcagaggccccggtccaaaaccacagcggggaagacaggggacaccaaatcgctcaataaggagcatcctaatcaggaggtagttgataacactcgcctggaaaatgccaacttcggcctacatatatcaagaatccgtaaagacagtggagaggaaaatgcccacccacgaagaggccaaatcattgacttccaagggctgctcacagatgccatcaagggagcaaccagtgaacttgccttgaacaccttcgaccataatccagacccctcagaacgactgctgaaacctctgagtgcatttattggcatgaacagtgagatgcgagaattggcagccgtggtgagccgggacatttatctccataatccaaacataaagtggaatgacattattggacttgatgcagccaagcagttagtcaaagaagctgttgtgtatcctataaggtatccacagctatttacaggaattctttctccctggaaaggactactgctgtacggccctccaggtacaggaaagactttactggccaaagctgtggccactgaatgtaaaacaaccttctttaacatttctgcatccaccattgtcagcaaatggagaggggattcagaaaaactcgttcgggtgttatttgagcttgcccgctaccacgccccatccacgatcttcctggacgagctggagtcggtgatgagtcagagaggcacagcttctgggggagaacatgaaggaagcctgcggatgaagacagagttactggtgcagatggatgggctggcacgctcagaagatctcgtatttgtcttagcagcttctaacctgccgtgggagctggactgtgccatgttacgccgcctggagaagaggattctggtcgatctccccagccgggaggccaggcaggccatgatctaccactggctgcctcctgtgagcaagagcagggccttggagctgcacacagagctggagtacagtgtgctgagccaggagactgagggctactcaggctcagatattaagctcgtctgcagggaagcagccatgcggcccgtgaggaagatctttgatgcacttgaaaatcaccagtcagaaagcagcgacttacccaggatccagttggatatagtaaccactgccgactttctggatgtgctaactcacaccaagccctccgcaaagaatctggctcagagatactcagactggcaaagagagttcgagtctgtctga
Sequence Length
1401
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
52,781 Da
NCBI Official Full Name
Homo sapiens katanin p60 subunit A-like 2, mRNA
NCBI Official Synonym Full Names
katanin catalytic subunit A1 like 2
NCBI Official Symbol
KATNAL2
NCBI Protein Information
katanin p60 ATPase-containing subunit A-like 2
UniProt Protein Name
Katanin p60 ATPase-containing subunit A-like 2
UniProt Gene Name
KATNAL2
UniProt Synonym Gene Names
Katanin p60 subunit A-like 2
UniProt Entry Name
KATL2_HUMAN

Uniprot Description

KATNAL2: Severs microtubules in vitro in an ATP-dependent manner. This activity may promote rapid reorganization of cellular microtubule arrays. Belongs to the AAA ATPase family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Hydrolase; EC 3.6.4.3

Chromosomal Location of Human Ortholog: 18q21.1

Cellular Component: nucleus

Molecular Function: microtubule-severing ATPase activity

Biological Process: cytoplasmic microtubule organization and biogenesis

Research Articles on KATNAL2

Similar Products

Product Notes

The KATNAL2 katnal2 (Catalog #AAA1273122) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaatatg agagttatta ttttgtaaaa tttcagaaat accccaaaat tgtcaaaaag tcatcagaca cagcagaaaa taatttaccg caaagaagta gagggaagac cagaaggatg atgaacgaca gttgtcaaaa tcttcccaag atcaatcagc agaggccccg gtccaaaacc acagcgggga agacagggga caccaaatcg ctcaataagg agcatcctaa tcaggaggta gttgataaca ctcgcctgga aaatgccaac ttcggcctac atatatcaag aatccgtaaa gacagtggag aggaaaatgc ccacccacga agaggccaaa tcattgactt ccaagggctg ctcacagatg ccatcaaggg agcaaccagt gaacttgcct tgaacacctt cgaccataat ccagacccct cagaacgact gctgaaacct ctgagtgcat ttattggcat gaacagtgag atgcgagaat tggcagccgt ggtgagccgg gacatttatc tccataatcc aaacataaag tggaatgaca ttattggact tgatgcagcc aagcagttag tcaaagaagc tgttgtgtat cctataaggt atccacagct atttacagga attctttctc cctggaaagg actactgctg tacggccctc caggtacagg aaagacttta ctggccaaag ctgtggccac tgaatgtaaa acaaccttct ttaacatttc tgcatccacc attgtcagca aatggagagg ggattcagaa aaactcgttc gggtgttatt tgagcttgcc cgctaccacg ccccatccac gatcttcctg gacgagctgg agtcggtgat gagtcagaga ggcacagctt ctgggggaga acatgaagga agcctgcgga tgaagacaga gttactggtg cagatggatg ggctggcacg ctcagaagat ctcgtatttg tcttagcagc ttctaacctg ccgtgggagc tggactgtgc catgttacgc cgcctggaga agaggattct ggtcgatctc cccagccggg aggccaggca ggccatgatc taccactggc tgcctcctgt gagcaagagc agggccttgg agctgcacac agagctggag tacagtgtgc tgagccagga gactgagggc tactcaggct cagatattaa gctcgtctgc agggaagcag ccatgcggcc cgtgaggaag atctttgatg cacttgaaaa tcaccagtca gaaagcagcg acttacccag gatccagttg gatatagtaa ccactgccga ctttctggat gtgctaactc acaccaagcc ctccgcaaag aatctggctc agagatactc agactggcaa agagagttcg agtctgtctg a. It is sometimes possible for the material contained within the vial of "KATNAL2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.