KATNAL1 cdna clone

KATNAL1 cDNA Clone

Synonyms

KATNAL1; KATNAL1 cDNA Clone; KATNAL1 cdna clone

Ordering
Cat. Num. AAA1278043 For Research Use Only!

Sequence

atgaatttggctgagatttgtgataatgcaaagaaaggaagagaatatgcccttcttggaaattacgactcatcaatggtatattaccagggggtgatgcagcagattcagagacattgccagtcagtcagagatccagctatcaaaggcaaatggcaacaggttcggcaggaattattggaggaatatgaacaagttaaaagtattgtcagcactttagaaagttttaaaattgacaagcctccagatttccctgtgtcctgtcaagatgaaccatttagagatcctgctgtttggccaccccctgttcctgcagaacacagagctccacctcagatcaggcgtcccaatcgagaagtaagacctctgaggaaagaaatggcaggagtaggagcccggggacctgtaggccgagcacatcctatatcaaagagtgaaaagccttctacaagtagggacaaggactatagagcaagagggagagatgacaagggaaggaagaatatgcaagatggtgcaagtgatggtgaaatgccaaaatttgatggtgctggttatgataaggatctggtggaagcccttgaaagagacattgtatccaggaatcctagcattcattgggatgacatagcagatctggaagaagctaagaagttgctaagggaagctgttgttcttccaatgtggatgcctgactttttcaaagggattagaaggccatggaagggtgtactgatggttggacccccaggcactggtaaaactatgctagctaaagctgttgccactgaatgtggtacaacattcttcaacgtttcgtcttctacactgacatctaaatacagaggtgaatctgagaagttagttcgtctgttgtttgagatggctagattttatgcccctaccacgatcttcattgatgagatagattctatctgcagtcgaagaggaacctctgatgaacatgaggcaagtcgcagggtcaagtctgaactgctcattcagatggatggagttggaggagctttagaaaatgatgatccttccaaaatggttatggtattggctgctactaatttcccgtgggacattgatgaagctttgcgaagaaggttagaaaaaaggatatatatacctctcccaacagcaaaaggaagagctgagcttctgaagatcaaccttcgtgaggtcgaattagatcctgatattcaactggaagatatagccgagaagattgagggctattctggtgctgacatcactaatgtttgcagggatgcctctttaatggcaatgagacggcgtatcaatggcttaagtccagaagaaatccgtgcactttctaaagaggaacttcagatgcctgttaccaaaggagactttgaattggccctaaagaaaattgctaagtctgtctctgctgcagacttggagaagtatgaaaaatggatggttgaatttggatctgcttga

Sequence Length

1473

Vector

Please Inquire

NCBI and Uniprot Product Information

NCBI GI #

33990827

NCBI GeneID

84056

Molecular Weight

55,392 Da

NCBI Official Full Name

Homo sapiens katanin p60 subunit A-like 1, mRNA

NCBI Official Synonym Full Names

katanin catalytic subunit A1 like 1

NCBI Official Symbol

KATNAL1

NCBI Protein Information

katanin p60 ATPase-containing subunit A-like 1

UniProt Protein Name

Katanin p60 ATPase-containing subunit A-like 1

Protein Family

Katanin p60 ATPase-containing

UniProt Gene Name

KATNAL1

UniProt Synonym Gene Names

Katanin p60 subunit A-like 1

UniProt Entry Name

KATL1_HUMAN

Uniprot Description

KATNAL1: Regulates microtubule dynamics in Sertoli cells, a process that is essential for spermiogenesis and male fertility. Severs microtubules in an ATP-dependent manner, promoting rapid reorganization of cellular microtubule arrays. Belongs to the AAA ATPase family.

Protein type: Hydrolase; EC 3.6.4.3

Chromosomal Location of Human Ortholog: 13q12.3

Cellular Component: nucleus

Molecular Function: microtubule-severing ATPase activity; protein binding

Biological Process: cytoplasmic microtubule organization and biogenesis

Research Articles on KATNAL1

1. microdeletion 13q12.3 represents a novel clinically recognizable condition and that the microtubule severing gene KATNAL1 and the chromatin-associated gene HMGB1 are candidate genes for intellectual disability inherited in an autosomal dominant pattern.

Similar Products

Product Notes

The KATNAL1 katnal1 (Catalog #AAA1278043) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaatttgg ctgagatttg tgataatgca aagaaaggaa gagaatatgc ccttcttgga aattacgact catcaatggt atattaccag ggggtgatgc agcagattca gagacattgc cagtcagtca gagatccagc tatcaaaggc aaatggcaac aggttcggca ggaattattg gaggaatatg aacaagttaa aagtattgtc agcactttag aaagttttaa aattgacaag cctccagatt tccctgtgtc ctgtcaagat gaaccattta gagatcctgc tgtttggcca ccccctgttc ctgcagaaca cagagctcca cctcagatca ggcgtcccaa tcgagaagta agacctctga ggaaagaaat ggcaggagta ggagcccggg gacctgtagg ccgagcacat cctatatcaa agagtgaaaa gccttctaca agtagggaca aggactatag agcaagaggg agagatgaca agggaaggaa gaatatgcaa gatggtgcaa gtgatggtga aatgccaaaa tttgatggtg ctggttatga taaggatctg gtggaagccc ttgaaagaga cattgtatcc aggaatccta gcattcattg ggatgacata gcagatctgg aagaagctaa gaagttgcta agggaagctg ttgttcttcc aatgtggatg cctgactttt tcaaagggat tagaaggcca tggaagggtg tactgatggt tggaccccca ggcactggta aaactatgct agctaaagct gttgccactg aatgtggtac aacattcttc aacgtttcgt cttctacact gacatctaaa tacagaggtg aatctgagaa gttagttcgt ctgttgtttg agatggctag attttatgcc cctaccacga tcttcattga tgagatagat tctatctgca gtcgaagagg aacctctgat gaacatgagg caagtcgcag ggtcaagtct gaactgctca ttcagatgga tggagttgga ggagctttag aaaatgatga tccttccaaa atggttatgg tattggctgc tactaatttc ccgtgggaca ttgatgaagc tttgcgaaga aggttagaaa aaaggatata tatacctctc ccaacagcaa aaggaagagc tgagcttctg aagatcaacc ttcgtgaggt cgaattagat cctgatattc aactggaaga tatagccgag aagattgagg gctattctgg tgctgacatc actaatgttt gcagggatgc ctctttaatg gcaatgagac ggcgtatcaa tggcttaagt ccagaagaaa tccgtgcact ttctaaagag gaacttcaga tgcctgttac caaaggagac tttgaattgg ccctaaagaa aattgctaag tctgtctctg ctgcagactt ggagaagtat gaaaaatgga tggttgaatt tggatctgct tga. It is sometimes possible for the material contained within the vial of "KATNAL1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Loading...

KATNAL1 cdna clone