Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

KATNA1 cdna clone

KATNA1 cDNA Clone

Synonyms
KATNA1; KATNA1 cDNA Clone; KATNA1 cdna clone
Ordering
For Research Use Only!
Sequence
atgagtcttcttatgattagtgagaatgtaaaattggctcgtgaatatgcattgctgggaaactatgactctgcgatggtctattatcagggagttcttgaccaaatgaacaagtatctgtactcagtcaaagatacatacctccagcagaaatggcaacaggtttggcaggaaataaatgtggaagctaaacatgttaaagatatcatgaaaacactagagagctttaaactggacagcactcccttgaaagcggcacagcatgaccttccagcttctgagggagaagtctggtccatgcctgtacctgttgaacgaagaccctcaccaggacctagaaaacgccaatcttctcagtacagtgaccctaaatcacatggtaatcgtccaagtacaactgtcagagttcaccgttcatctgcacagaatgttcacaatgacagagggaaagctgttcgttgtcgtgaaaagaaagaacagaataaaggaagagaggaaaagggagtactgatggtcggcccacctggcacggggaagacgctccttgctaaagcagtagctacagaatgcaagacaacattcttcaatgtctcttcatcaactttgacttccaaatacagaggagaatctgagaagcttgttcgtcttctgtttgaaatggctcgattttattctccagccaccatatttattgatgagatagactccatctgtagtcgccgagggacttctgaagaacatgaagcaagcagaagggtgaaagcggagctgctggttcagatggatggtgttggaggtacttctgaaaatgatgacccttccaaaatggttatggttctggcagctactaattttccctgggatatagatgaggctttaagacgacgccttgagaaacgaatctatattcctttgccgtcagggatgcgtccttga
Sequence Length
936
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
35,319 Da
NCBI Official Full Name
Homo sapiens katanin p60 (ATPase-containing) subunit A 1, mRNA
NCBI Official Synonym Full Names
katanin catalytic subunit A1
NCBI Official Symbol
KATNA1
NCBI Protein Information
katanin p60 ATPase-containing subunit A1
UniProt Protein Name
Katanin p60 ATPase-containing subunit A1
UniProt Gene Name
KATNA1
UniProt Synonym Gene Names
Katanin p60 subunit A1
UniProt Entry Name
KTNA1_HUMAN

NCBI Description

Microtubules, polymers of alpha and beta tubulin subunits, form the mitotic spindle of a dividing cell and help to organize membranous organelles during interphase. Katanin is a heterodimer that consists of a 60 kDa ATPase (p60 subunit A 1) and an 80 kDa accessory protein (p80 subunit B 1). The p60 subunit acts to sever and disassemble microtubules, while the p80 subunit targets the enzyme to the centrosome. This gene encodes the p80 subunit. This protein is a member of the AAA family of ATPases. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Feb 2011]

Uniprot Description

KATNA1: Severs microtubules in vitro in an ATP-dependent manner. This activity may promote rapid reorganization of cellular microtubule arrays, such as during disassembly of interphase microtubules at the G2-M transition. May also be required for microtubule release from the centrosome after nucleation. In mitotic spindles this could allow depolymerization of the microtubule end proximal to the centrosome, and subsequent poleward microtubule flux. In neurons, microtubule release within the cell body may allow their subsequent transport into neuronal processes by microtubule dependent motor proteins. This transport is required for axonal growth. Belongs to the AAA ATPase family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Hydrolase; Motility/polarity/chemotaxis; EC 3.6.4.3

Chromosomal Location of Human Ortholog: 6q25.1

Cellular Component: cytoplasm; microtubule organizing center; midbody; nucleus; spindle; spindle pole

Molecular Function: microtubule binding; microtubule-severing ATPase activity; protein binding; protein heterodimerization activity

Biological Process: cytoplasmic microtubule organization and biogenesis

Research Articles on KATNA1

Similar Products

Product Notes

The KATNA1 katna1 (Catalog #AAA1272198) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagtcttc ttatgattag tgagaatgta aaattggctc gtgaatatgc attgctggga aactatgact ctgcgatggt ctattatcag ggagttcttg accaaatgaa caagtatctg tactcagtca aagatacata cctccagcag aaatggcaac aggtttggca ggaaataaat gtggaagcta aacatgttaa agatatcatg aaaacactag agagctttaa actggacagc actcccttga aagcggcaca gcatgacctt ccagcttctg agggagaagt ctggtccatg cctgtacctg ttgaacgaag accctcacca ggacctagaa aacgccaatc ttctcagtac agtgacccta aatcacatgg taatcgtcca agtacaactg tcagagttca ccgttcatct gcacagaatg ttcacaatga cagagggaaa gctgttcgtt gtcgtgaaaa gaaagaacag aataaaggaa gagaggaaaa gggagtactg atggtcggcc cacctggcac ggggaagacg ctccttgcta aagcagtagc tacagaatgc aagacaacat tcttcaatgt ctcttcatca actttgactt ccaaatacag aggagaatct gagaagcttg ttcgtcttct gtttgaaatg gctcgatttt attctccagc caccatattt attgatgaga tagactccat ctgtagtcgc cgagggactt ctgaagaaca tgaagcaagc agaagggtga aagcggagct gctggttcag atggatggtg ttggaggtac ttctgaaaat gatgaccctt ccaaaatggt tatggttctg gcagctacta attttccctg ggatatagat gaggctttaa gacgacgcct tgagaaacga atctatattc ctttgccgtc agggatgcgt ccttga. It is sometimes possible for the material contained within the vial of "KATNA1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.