Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

KAT2A cdna clone

KAT2A cDNA Clone

Gene Names
KAT2A; GCN5; hGCN5; GCN5L2; PCAF-b
Synonyms
KAT2A; KAT2A cDNA Clone; KAT2A cdna clone
Ordering
For Research Use Only!
Sequence
atggcggaaccttcccaggccccgaccccggccccggctgcgcagccccggccccttcagtccccagcccctgccccaactccgactcctgcacccagcccggcttcagccccgattccgactcccaccccggcaccagcccctgccccagctgcagccccagccggcagcacagggactggggggcccggggtaggaagtgggggggccgggagcgggggggatccggctcgacctggcctgagccagcagcagcgcgccagtcagaggaaggcgcaagtccgggggctgccgcgcgccaagaagcttgagaagctaggggtcttctcggcttgcaaggccaatgaaacctgtaagtgtaatggctggaaaaaccccaagccccccactgcaccccgcatggatctgcagcagccagctgccaacctgagtgagctgtgccgcagttgtgagcaccccttggctgaccacgtatcccacttggagaatgtgtcagaggatgagataaaccgactgctggggatggtggtggatgtggagaatctcttcatgtctgttcacaaggaagaggacacagacaccaagcaggtctatttctacctcttcaagctactgcggaaatgcatcctgcagatgacccggcctgtggtggaggggtccctgggcagccctccatttgagaaacctaatattgagcagggtgtgctgaactttgtgcagtacaagtttagtcacctggctccccgggagcggcagacgatgttcgagctctcaaagatgttcttgctctgccttaactactggaagcttgagacacctgcccagtttcggcagaggtctcaggctgaggacgtggctacctacaaggtcaattacaccagatggctctgttactgccacgtgccccagagctgtgatagcctcccccgctacgaaaccactcatgtctttgggcgaagccttctccggtccattttcaccgttacccgccggcagctgctggaaaagttccgagtggagaaggacaaattggtgcccgagaagaggaccctcatcctcactcacttccccaaattcctgtccatgctggaggaggagatctatggggcaaactctccaatctgggagtcaggcttcaccatgccaccctcagaggggacacagctggttccccggccagcttcagtcagtgcagcggttgttcccagcacccccatcttcagccccagcatgggtgggggcagcaacagctccctgagtctggattctgcaggggccgagcctatgccaggcgagaagaggacgctcccagagaacctgaccctggaggatgccaagcggctccgtgtgatgggtgacatccccatggagctggtcaatgaggtcatgctgaccatcactgaccctgctgccatgctggggcctgagacgagcctgctttcggccaatgcggcccgggatgagacagcccgcctggaggagcgccgcggcatcatcgagttccatgtcatcggcaactcactgacgcccaaggccaaccggcgggtgttgctgtggctcgtggggctgcagaatgtcttttcccaccagctgccgcgcatgcctaaggagtatatcgcccgcctcgtctttgacccgaagcacaagactctggccttgatcaaggatgggcgggtcatcggtggcatctgcttccgcatgtttcccacccagggcttcacggagattgtcttctgtgctgtcacctcgaatgagcaggtcaagggttatgggacccacctgatgaaccacctgaaggagtatcacatcaagcacaacattctctacttcctcacctacgccgacgagtacgccatcggctacttcaaaaagcagggtttctccaaggacatcaaggtgcccaagagccgctacctgggctacatcaaggactacgagggagcgacgctgatggagtgtgagctgaatccccgcatcccctacacggagctgtcccacatcatcaagaagcagaaagagatcatcaagaagctgattgagcgcaaacaggcccagatccgcaaggtctacccggggctcagctgcttcaaggagggcgtgaggcagatccctgtggagagcgttcctggcattcgagagacaggctggaagccattggggaaggagaaggggaaggagctgaaggaccccgaccagctctacacaaccctcaaaaacctgctggcccaaatcaagtctcaccccagtgcctggcccttcatggagcctgtgaagaagtcggaggcccctgactactacgaggtcatccgcttccccattgacctgaagaccatgactgagcggctgcgaagccgctactacgtgacccggaagctctttgtggccgacctgcagcgggtcatcgccaactgtcgcgagtacaaccccccggacagcgagtactgccgctgtgccagcgccctggagaagttcttctacttcaagctcaaggagggaggcctcattgacaagtag
Sequence Length
2514
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
48,921 Da
NCBI Official Full Name
Homo sapiens K(lysine) acetyltransferase 2A, mRNA
NCBI Official Synonym Full Names
lysine acetyltransferase 2A
NCBI Official Symbol
KAT2A
NCBI Official Synonym Symbols
GCN5; hGCN5; GCN5L2; PCAF-b
NCBI Protein Information
histone acetyltransferase KAT2A
UniProt Protein Name
Histone acetyltransferase KAT2A
Protein Family
UniProt Gene Name
KAT2A
UniProt Synonym Gene Names
GCN5; GCN5L2; HGCN5; HsGCN5
UniProt Entry Name
KAT2A_HUMAN

NCBI Description

KAT2A, or GCN5, is a histone acetyltransferase (HAT) that functions primarily as a transcriptional activator. It also functions as a repressor of NF-kappa-B (see MIM 164011) by promoting ubiquitination of the NF-kappa-B subunit RELA (MIM 164014) in a HAT-independent manner (Mao et al., 2009 [PubMed 19339690]).[supplied by OMIM, Sep 2009]

Uniprot Description

GCN5: an ubiquitous histone acetyltransferase that promotes transcriptional activation. Acetylation of histones gives a specific tag for epigenetic transcription activation. Has significant histone acetyltransferase activity with core histones, but not with nucleosome core particles. Interacts with P300, CBP, ADA2, and is a component of the TFTC-HAT complex. Two splice variant isoforms have been described.

Protein type: Acetyltransferase; EC 2.3.1.48

Chromosomal Location of Human Ortholog: 17q21

Cellular Component: extracellular space; nucleoplasm

Molecular Function: H3 histone acetyltransferase activity; histone acetyltransferase activity; histone deacetylase binding; protein binding; transcription coactivator activity; transcription factor binding

Biological Process: chromatin remodeling; histone deubiquitination; positive regulation of gene expression, epigenetic; regulation of protein stability; regulation of transcription from RNA polymerase II promoter; transcription from RNA polymerase II promoter

Research Articles on KAT2A

Similar Products

Product Notes

The KAT2A kat2a (Catalog #AAA1270201) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggaac cttcccaggc cccgaccccg gccccggctg cgcagccccg gccccttcag tccccagccc ctgccccaac tccgactcct gcacccagcc cggcttcagc cccgattccg actcccaccc cggcaccagc ccctgcccca gctgcagccc cagccggcag cacagggact ggggggcccg gggtaggaag tgggggggcc gggagcgggg gggatccggc tcgacctggc ctgagccagc agcagcgcgc cagtcagagg aaggcgcaag tccgggggct gccgcgcgcc aagaagcttg agaagctagg ggtcttctcg gcttgcaagg ccaatgaaac ctgtaagtgt aatggctgga aaaaccccaa gccccccact gcaccccgca tggatctgca gcagccagct gccaacctga gtgagctgtg ccgcagttgt gagcacccct tggctgacca cgtatcccac ttggagaatg tgtcagagga tgagataaac cgactgctgg ggatggtggt ggatgtggag aatctcttca tgtctgttca caaggaagag gacacagaca ccaagcaggt ctatttctac ctcttcaagc tactgcggaa atgcatcctg cagatgaccc ggcctgtggt ggaggggtcc ctgggcagcc ctccatttga gaaacctaat attgagcagg gtgtgctgaa ctttgtgcag tacaagttta gtcacctggc tccccgggag cggcagacga tgttcgagct ctcaaagatg ttcttgctct gccttaacta ctggaagctt gagacacctg cccagtttcg gcagaggtct caggctgagg acgtggctac ctacaaggtc aattacacca gatggctctg ttactgccac gtgccccaga gctgtgatag cctcccccgc tacgaaacca ctcatgtctt tgggcgaagc cttctccggt ccattttcac cgttacccgc cggcagctgc tggaaaagtt ccgagtggag aaggacaaat tggtgcccga gaagaggacc ctcatcctca ctcacttccc caaattcctg tccatgctgg aggaggagat ctatggggca aactctccaa tctgggagtc aggcttcacc atgccaccct cagaggggac acagctggtt ccccggccag cttcagtcag tgcagcggtt gttcccagca cccccatctt cagccccagc atgggtgggg gcagcaacag ctccctgagt ctggattctg caggggccga gcctatgcca ggcgagaaga ggacgctccc agagaacctg accctggagg atgccaagcg gctccgtgtg atgggtgaca tccccatgga gctggtcaat gaggtcatgc tgaccatcac tgaccctgct gccatgctgg ggcctgagac gagcctgctt tcggccaatg cggcccggga tgagacagcc cgcctggagg agcgccgcgg catcatcgag ttccatgtca tcggcaactc actgacgccc aaggccaacc ggcgggtgtt gctgtggctc gtggggctgc agaatgtctt ttcccaccag ctgccgcgca tgcctaagga gtatatcgcc cgcctcgtct ttgacccgaa gcacaagact ctggccttga tcaaggatgg gcgggtcatc ggtggcatct gcttccgcat gtttcccacc cagggcttca cggagattgt cttctgtgct gtcacctcga atgagcaggt caagggttat gggacccacc tgatgaacca cctgaaggag tatcacatca agcacaacat tctctacttc ctcacctacg ccgacgagta cgccatcggc tacttcaaaa agcagggttt ctccaaggac atcaaggtgc ccaagagccg ctacctgggc tacatcaagg actacgaggg agcgacgctg atggagtgtg agctgaatcc ccgcatcccc tacacggagc tgtcccacat catcaagaag cagaaagaga tcatcaagaa gctgattgag cgcaaacagg cccagatccg caaggtctac ccggggctca gctgcttcaa ggagggcgtg aggcagatcc ctgtggagag cgttcctggc attcgagaga caggctggaa gccattgggg aaggagaagg ggaaggagct gaaggacccc gaccagctct acacaaccct caaaaacctg ctggcccaaa tcaagtctca ccccagtgcc tggcccttca tggagcctgt gaagaagtcg gaggcccctg actactacga ggtcatccgc ttccccattg acctgaagac catgactgag cggctgcgaa gccgctacta cgtgacccgg aagctctttg tggccgacct gcagcgggtc atcgccaact gtcgcgagta caaccccccg gacagcgagt actgccgctg tgccagcgcc ctggagaagt tcttctactt caagctcaag gagggaggcc tcattgacaa gtag. It is sometimes possible for the material contained within the vial of "KAT2A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.