Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

JAM2 cdna clone

JAM2 cDNA Clone

Gene Names
JAM2; JAMB; CD322; JAM-B; VEJAM; PRO245; VE-JAM; C21orf43
Synonyms
JAM2; JAM2 cDNA Clone; JAM2 cdna clone
Ordering
For Research Use Only!
Sequence
atggcgaggaggagccgccaccgcctcctcctgctgctgctgcgctacctggtggtcgccctgggctatcataaggcctatgggttttctgccccaaaagaccaacaagtagtcacagcagtagagtaccaagaggctattttagcctgcaaaaccccaaagaagactgtttcctccagattagagtggaagaaactgggtcggagtgtctcctttgtctactatcaacagactcttcaaggtgattttaaaaatcgagctgagatgatagatttcaatatccggatcaaaaatgtgacaagaagtgatgcggggaaatatcgttgtgaagttagtgccccatctgagcaaggccaaaacctggaagaggatacagtcactctggaagtattagtggctccagcagttccatcatgtgaagtaccctcttctgctctgagtggaactgtggtagagctacgatgtcaagacaaagaagggaatccagctcctgaatacacatggtttaaggatggcatccgtttgctagaaaatcccagacttggctcccaaagcaccaacagctcatacacaatgaatacaaaaactggaactctgcaatttaatactgtttccaaactggacactggagaatattcctgtgaagcccgcaattctgttggatatcgcaggtgtcctgggaaacgaatgcaagtagatgatctcaacataagtggcatcatagcagccgtagtagttgtggccttagtgatttccgtttgtggccttggtgtatgctatgctcagaggaaaggctacttttcaaaagaaacctccttccagaagagtaattcttcatctaaagccacgacaatgagtgaaaatgatttcaagcacacaaaatcctttataatttaa
Sequence Length
897
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
34,554 Da
NCBI Official Full Name
Homo sapiens junctional adhesion molecule 2, mRNA
NCBI Official Synonym Full Names
junctional adhesion molecule 2
NCBI Official Symbol
JAM2
NCBI Official Synonym Symbols
JAMB; CD322; JAM-B; VEJAM; PRO245; VE-JAM; C21orf43
NCBI Protein Information
junctional adhesion molecule B
UniProt Protein Name
Junctional adhesion molecule B
UniProt Gene Name
JAM2
UniProt Synonym Gene Names
C21orf43; VEJAM; JAM-B; JAM-2; VE-JAM
UniProt Entry Name
JAM2_HUMAN

NCBI Description

This gene belongs to the immunoglobulin superfamily, and the junctional adhesion molecule (JAM) family. The protein encoded by this gene is a type I membrane protein that is localized at the tight junctions of both epithelial and endothelial cells. It acts as an adhesive ligand for interacting with a variety of immune cell types, and may play a role in lymphocyte homing to secondary lymphoid organs. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2012]

Uniprot Description

JAM2: May play a role in the processes of lymphocyte homing to secondary lymphoid organs. Belongs to the immunoglobulin superfamily.

Protein type: Membrane protein, integral; Cell adhesion

Chromosomal Location of Human Ortholog: 21q21.2

Cellular Component: plasma membrane

Molecular Function: protein binding

Biological Process: extracellular matrix organization and biogenesis; leukocyte migration

Research Articles on JAM2

Similar Products

Product Notes

The JAM2 jam2 (Catalog #AAA1269406) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgagga ggagccgcca ccgcctcctc ctgctgctgc tgcgctacct ggtggtcgcc ctgggctatc ataaggccta tgggttttct gccccaaaag accaacaagt agtcacagca gtagagtacc aagaggctat tttagcctgc aaaaccccaa agaagactgt ttcctccaga ttagagtgga agaaactggg tcggagtgtc tcctttgtct actatcaaca gactcttcaa ggtgatttta aaaatcgagc tgagatgata gatttcaata tccggatcaa aaatgtgaca agaagtgatg cggggaaata tcgttgtgaa gttagtgccc catctgagca aggccaaaac ctggaagagg atacagtcac tctggaagta ttagtggctc cagcagttcc atcatgtgaa gtaccctctt ctgctctgag tggaactgtg gtagagctac gatgtcaaga caaagaaggg aatccagctc ctgaatacac atggtttaag gatggcatcc gtttgctaga aaatcccaga cttggctccc aaagcaccaa cagctcatac acaatgaata caaaaactgg aactctgcaa tttaatactg tttccaaact ggacactgga gaatattcct gtgaagcccg caattctgtt ggatatcgca ggtgtcctgg gaaacgaatg caagtagatg atctcaacat aagtggcatc atagcagccg tagtagttgt ggccttagtg atttccgttt gtggccttgg tgtatgctat gctcagagga aaggctactt ttcaaaagaa acctccttcc agaagagtaa ttcttcatct aaagccacga caatgagtga aaatgatttc aagcacacaa aatcctttat aatttaa. It is sometimes possible for the material contained within the vial of "JAM2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.