ITGB5 cdna clone
ITGB5 cDNA Clone
Synonyms
ITGB5; ITGB5 cDNA Clone; ITGB5 cdna clone
Sequence
atgccgcgggccccggcgccgctgtacgcctgcctcctggggctctgcgcgctcctgccccggctcgcaggtctcaacatatgcactagtggaagtgccacctcatgtgaagaatgtctgctaatccacccaaaatgtgcctggtgctccaaagaggacttcggaagcccacggtccatcacctctcggtgtgatctgagggcaaaccttgtcaaaaatggctgtggaggtgagatagagagcccagccagcagcttccatgtcctgaggagcctgcccctcagcagcaagggttcgggctctgcaggctgggacgtcattcagatgacaccacaggagattgccgtgaacctccggcccggtgacaagaccaccttccagctacaggttcgccaggtggaggactatcctgtggacctgtactacctgatggacctctccctgtccatgaaggatgacttggacaatatccggagcctgggcaccaaactcgcggaggagatgaggaagctcaccagcaacttccggttgggatttgggtcttttgttgataaggacatctctcctttctcctacacggcaccgaggtaccagaccaatccgtgcattggttacaagttgtttccaaattgcgtcccctcctttgggttccgccatctgctgcctctcacagacagagtggacagcttcaatgaggaagttcggaaacagagggtgtcccggaaccgagatgcccctgaggggggctttgatgcagtactccaggcagccgtctgcaaggagaagattggctggcgaaaggatgcactgcatttgctggtgttcacaacagatgatgtgccccacatcgcattggatggaaaattgggaggcctggtgcagccacacgatggccagtgccacctgaacgaggccaacgagtacactgcatccaaccagatggactatccatcccttgccttgcttggagagaaattggcagagaacaacatcaacctcatctttgcagtgacaaaaaaccattatatgctgtacaagaattttacagccctgatacctggaacaacggtggagattttagatggagactccaaaaatattattcaactgattattaatgcatacaatagtatccggtctaaagtggagttgtcagtctgggatcagcctgaggatcttaatctcttctttactgctacctgccaagatggggtatcctatcctggtcagaggaagtgtgagggtctgaagattggggacacggcatcttttgaagtatcattggaggcccgaagctgtcccagcagacacacggagcatgtgtttgccctgcggccggtgggattccgggacagcctggaggtgggggtcacctacaactgcacgtgcggctgcagcgtggggctggaacccaacagtgccaggtgcaacgggagcgggacctatgtctgcggcctgtgtgagtgcagccccggctacctgggcaccaggtgcgagtgccaggatggggagaaccagagcgtgtaccagaacctgtgccgggaggcagagggcaagccactgtgcagcgggcgtggggactgcagctgcaaccagtgctcctgcttcgagagcgagttcggcaagatctatgggcctttctgtgagtgcgacaacttctcctgtgccaggaacaagggagtcctctgctcaggccatggcgagtgtcactgcggggaatgcaagtgccatgcaggttacatcggggacaactgtaactgctcgacagacatcagcacatgccggggcagagatggccagatctgcagcgagcgtgggcactgtctctgtgggcagtgccaatgcacggagccgggggcctttggggagatgtgtgagaagtgccccacctgcccggatgcatgcagcaccaagagagattgcgtcgagtgcctgctgctccactctgggaaacctgacaaccagacctgccacagcctatgcagggatgaggtgatcacatgggtggacaccatcgtgaaagatgaccaggaggctgtgctatgtttctacaaaaccgccaaggactgcgtcatgatgttcacctatgtggagctccccagtgggaagtccaacctgaccgtcctcagggagccagagtgtggaaacacccccaacgccatgaccatcctcctggctgtggtcggtagcatcctccttgttgggcttgcactcctggctatctggaagctgcttgtcaccatccacgaccggagggagtttgcaaagtttcagagcgagcgatccagggcccgctatgaaatggcttcaaatccattatacagaaagcctatctccacgcacactgtggacttcaccttcaacaagttcaacaaatcctacaatggcactgtggactga
Sequence Length
2400
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
88,054 Da
NCBI Official Full Name
Homo sapiens integrin, beta 5, mRNA
NCBI Official Synonym Full Names
integrin subunit beta 5
NCBI Official Symbol
ITGB5
NCBI Protein Information
integrin beta-5
UniProt Protein Name
Integrin beta-5
Protein Family
UniProt Gene Name
ITGB5
UniProt Entry Name
ITB5_HUMAN
Uniprot Description
ITGB5: Integrin alpha-V/beta-5 is a receptor for fibronectin. It recognizes the sequence R-G-D in its ligand. Heterodimer of an alpha and a beta subunit. Beta-5 associates with alpha-V. Interacts with MYO10. Belongs to the integrin beta chain family.
Protein type: Motility/polarity/chemotaxis; Membrane protein, integral; Cell adhesion
Chromosomal Location of Human Ortholog: 3q21.2
Cellular Component: cell surface; focal adhesion; phagocytic vesicle; plasma membrane; receptor complex
Molecular Function: protein binding
Biological Process: antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent; cell-matrix adhesion; extracellular matrix organization and biogenesis; integrin-mediated signaling pathway; muscle contraction; stress fiber formation; transforming growth factor beta receptor signaling pathway
Research Articles on ITGB5
Similar Products
Product Notes
The ITGB5 itgb5 (Catalog #AAA1274287) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccgcggg ccccggcgcc gctgtacgcc tgcctcctgg ggctctgcgc gctcctgccc cggctcgcag gtctcaacat atgcactagt ggaagtgcca cctcatgtga agaatgtctg ctaatccacc caaaatgtgc ctggtgctcc aaagaggact tcggaagccc acggtccatc acctctcggt gtgatctgag ggcaaacctt gtcaaaaatg gctgtggagg tgagatagag agcccagcca gcagcttcca tgtcctgagg agcctgcccc tcagcagcaa gggttcgggc tctgcaggct gggacgtcat tcagatgaca ccacaggaga ttgccgtgaa cctccggccc ggtgacaaga ccaccttcca gctacaggtt cgccaggtgg aggactatcc tgtggacctg tactacctga tggacctctc cctgtccatg aaggatgact tggacaatat ccggagcctg ggcaccaaac tcgcggagga gatgaggaag ctcaccagca acttccggtt gggatttggg tcttttgttg ataaggacat ctctcctttc tcctacacgg caccgaggta ccagaccaat ccgtgcattg gttacaagtt gtttccaaat tgcgtcccct cctttgggtt ccgccatctg ctgcctctca cagacagagt ggacagcttc aatgaggaag ttcggaaaca gagggtgtcc cggaaccgag atgcccctga ggggggcttt gatgcagtac tccaggcagc cgtctgcaag gagaagattg gctggcgaaa ggatgcactg catttgctgg tgttcacaac agatgatgtg ccccacatcg cattggatgg aaaattggga ggcctggtgc agccacacga tggccagtgc cacctgaacg aggccaacga gtacactgca tccaaccaga tggactatcc atcccttgcc ttgcttggag agaaattggc agagaacaac atcaacctca tctttgcagt gacaaaaaac cattatatgc tgtacaagaa ttttacagcc ctgatacctg gaacaacggt ggagatttta gatggagact ccaaaaatat tattcaactg attattaatg catacaatag tatccggtct aaagtggagt tgtcagtctg ggatcagcct gaggatctta atctcttctt tactgctacc tgccaagatg gggtatccta tcctggtcag aggaagtgtg agggtctgaa gattggggac acggcatctt ttgaagtatc attggaggcc cgaagctgtc ccagcagaca cacggagcat gtgtttgccc tgcggccggt gggattccgg gacagcctgg aggtgggggt cacctacaac tgcacgtgcg gctgcagcgt ggggctggaa cccaacagtg ccaggtgcaa cgggagcggg acctatgtct gcggcctgtg tgagtgcagc cccggctacc tgggcaccag gtgcgagtgc caggatgggg agaaccagag cgtgtaccag aacctgtgcc gggaggcaga gggcaagcca ctgtgcagcg ggcgtgggga ctgcagctgc aaccagtgct cctgcttcga gagcgagttc ggcaagatct atgggccttt ctgtgagtgc gacaacttct cctgtgccag gaacaaggga gtcctctgct caggccatgg cgagtgtcac tgcggggaat gcaagtgcca tgcaggttac atcggggaca actgtaactg ctcgacagac atcagcacat gccggggcag agatggccag atctgcagcg agcgtgggca ctgtctctgt gggcagtgcc aatgcacgga gccgggggcc tttggggaga tgtgtgagaa gtgccccacc tgcccggatg catgcagcac caagagagat tgcgtcgagt gcctgctgct ccactctggg aaacctgaca accagacctg ccacagccta tgcagggatg aggtgatcac atgggtggac accatcgtga aagatgacca ggaggctgtg ctatgtttct acaaaaccgc caaggactgc gtcatgatgt tcacctatgt ggagctcccc agtgggaagt ccaacctgac cgtcctcagg gagccagagt gtggaaacac ccccaacgcc atgaccatcc tcctggctgt ggtcggtagc atcctccttg ttgggcttgc actcctggct atctggaagc tgcttgtcac catccacgac cggagggagt ttgcaaagtt tcagagcgag cgatccaggg cccgctatga aatggcttca aatccattat acagaaagcc tatctccacg cacactgtgg acttcacctt caacaagttc aacaaatcct acaatggcac tgtggactga. It is sometimes possible for the material contained within the vial of "ITGB5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
