Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ITGB1 cdna clone

ITGB1 cDNA Clone

Gene Names
ITGB1; CD29; FNRB; MDF2; VLAB; GPIIA; MSK12; VLA-BETA
Synonyms
ITGB1; ITGB1 cDNA Clone; ITGB1 cdna clone
Ordering
For Research Use Only!
Sequence
atgaatttacaaccaattttctggattggactgatcagttcagtttgctgtgtgtttgctcaaacagatgaaaatagatgtttaaaagcaaatgccaaatcatgtggagaatgtatacaagcagggccaaattgtgggtggtgcacaaattcaacatttttacaggaaggaatgcctacttctgcacgatgtgatgatttagaagccttaaaaaagaagggttgccctccagatgacatagaaaatcccagaggctccaaagatataaagaaaaataaaaatgtaaccaaccgtagcaaaggaacagcagagaagctcaagccagaggatattactcagatccaaccacagcagttggttttgcgattaagatcaggggagccacagacatttacattaaaattcaagagagctgaagactatcccattgacctctactaccttatggacctgtcttactcaatgaaagacgatttggagaatgtaaaaagtcttggaacagatctgatgaatgaaatgaggaggattacttcggacttcagaattggatttggctcatttgtggaaaagactgtgatgccttacattagcacaacaccagctaagctcaggaacccttgcacaagtgaacagaactgcaccagcccatttagctacaaaaatgtgctcagtcttactaataaaggagaagtatttaatgaacttgttggaaaacagcgcatatctggaaatttggattctccagaaggtggtttcgatgccatcatgcaagttgcagtttgtggatcactgattggctggaggaatgttacacggctgctggtgttttccacagatgccgggtttcactttgctggagatgggaaacttggtggcattgttttaccaaatgatggacaatgtcacctggaaaataatatgtacacaatgagccattattatgattatccttctattgctcaccttgtccagaaactgagtgaaaataatattcagacaatttttgcagttactgaagaatttcagcctgtttacaaggagctgaaaaacttgatccctaagtcagcagtaggaacattatctgcaaattctagcaatgtaattcagttgatcattgatgcatacaattccctttcctcagaagtcattttggaaaacggcaaattgtcagaaggagtaacaataagttacaaatcttactgcaagaacggggtgaatggaacaggggaaaatggaagaaaatgttccaatatttccattggagatgaggttcaatttgaaattagcataacttcaaataagtgtccaaaaaaggattctgacagctttaaaattaggcctctgggctttacggaggaagtagaggttattcttcagtacatctgtgaatgtgaatgccaaagcgaaggcatccctgaaagtcccaagtgtcatgaaggaaatgggacatttgagtgtggcgcgtgcaggtgcaatgaagggcgtgttggtagacattgtgaatgcagcacagatgaagttaacagtgaagacatggatgcttactgcaggaaagaaaacagttcagaaatctgcagtaacaatggagagtgcgtctgcggacagtgtgtttgtaggaagagggataatacaaatgaaatttattctggcaaattctgcgagtgtgataatttcaactgtgatagatccaatggcttaatttgtggaggaaatggtgtttgcaagtgtcgtgtgtgtgagtgcaaccccaactacactggcagtgcatgtgactgttctttggatactagtacttgtgaagccagcaacggacagatctgcaatggccggggcatctgtgagtgtggtgtctgtaagtgtacagatccgaagtttcaagggcaaacgtgtgagatgtgtcagacctgccttggtgtctgtgctgagcataaagaatgtgttcagtgcagagccttcaataaaggagaaaagaaagacacatgcacacaggaatgttcctattttaacattaccaaggtagaaagtcgggacaaattaccccagccggtccaacctgatcctgtgtcccattgtaaggagaaggatgttgacgactgttggttctattttacgtattcagtgaatgggaacaacgaggtcatggttcatgttgtggagaatccagagtgtcccactggtccagacatcattccaattgtagctggtgtggttgctggaattgttcttattggccttgcattactgctgatatggaagcttttaatgataattcatgacagaagggagtttgctaaatttgaaaaggagaaaatgaatgccaaatgggacacgggtgaaaatcctatttataagagtgccgtaacaactgtggtcaatccgaagtatgagggaaaatga
Sequence Length
2397
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
88,884 Da
NCBI Official Full Name
Homo sapiens integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12), mRNA
NCBI Official Synonym Full Names
integrin subunit beta 1
NCBI Official Symbol
ITGB1
NCBI Official Synonym Symbols
CD29; FNRB; MDF2; VLAB; GPIIA; MSK12; VLA-BETA
NCBI Protein Information
integrin beta-1
UniProt Protein Name
Integrin beta-1
Protein Family
UniProt Gene Name
ITGB1
UniProt Synonym Gene Names
FNRB; MDF2; MSK12; GPIIA
UniProt Entry Name
ITB1_HUMAN

NCBI Description

Integrins are heterodimeric proteins made up of alpha and beta subunits. At least 18 alpha and 8 beta subunits have been described in mammals. Integrin family members are membrane receptors involved in cell adhesion and recognition in a variety of processes including embryogenesis, hemostasis, tissue repair, immune response and metastatic diffusion of tumor cells. This gene encodes a beta subunit. Multiple alternatively spliced transcript variants which encode different protein isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

ITGB1: an integral membrane protein that heterodimerizes with an alpha-3 chain, forming a receptor for many extracellular-matrix proteins including fibronectin, laminin, collagen, epiligrin and thrombospondin. . Beta 1 integrins recognize the amino-acid motif RGD in a wide array of ligands. Five alternatively spliced variants with alternate carboxy termini have been described. Two alternatively spliced isoforms have been described. Isoform beta-1a is widely expressed; other isoforms are generally expressed with a more restricted distribution. Isoform beta-1b is expressed in skin, liver, skeletal muscle, cardiac muscle, placenta, umbilical vein endothelial cells, neuroblastoma cells, lymphoma cells, hepatoma cells and astrocytoma cells. Isoforms beta-1c and beta-1c-2 are expressed in muscle, kidney, liver, placenta, cervical epithelium, umbilical vein endothelial cells, fibroblast cells, embryonal kidney cells, platelets and several blood cell lines. Isoform beta-c-2, rather than isoform beta-1c, is selectively expressed in primary t-cells. Isoform beta-1c is expressed in nonproliferating and differentiated prostate gland epithelial cells. Isoform beta-1d is expressed specifically in striated muscle (skeletal and cardiac muscle).

Protein type: Cell surface; Motility/polarity/chemotaxis; Membrane protein, integral; Receptor, misc.; Cell adhesion

Chromosomal Location of Human Ortholog: 10p11.2

Cellular Component: cell surface; cell-cell adherens junction; cytoplasm; filopodium; focal adhesion; lipid raft; membrane; neuromuscular junction; plasma membrane; receptor complex; ruffle; sarcolemma

Molecular Function: actin binding; C-X3-C chemokine binding; cell adhesion molecule binding; coreceptor activity; fibronectin binding; protease binding; protein binding; protein complex binding; protein heterodimerization activity

Biological Process: B cell differentiation; calcium-independent cell-matrix adhesion; cell migration; cell-cell adhesion mediated by integrin; cell-matrix adhesion; cell-substrate adhesion; cellular defense response; extracellular matrix organization and biogenesis; heterotypic cell-cell adhesion; homophilic cell adhesion; integrin-mediated signaling pathway; leukocyte adhesion; leukocyte migration; leukocyte tethering or rolling; mesodermal cell differentiation; positive regulation of apoptosis; positive regulation of GTPase activity; receptor internalization; regulation of immune response; stress fiber formation; transforming growth factor beta receptor signaling pathway

Research Articles on ITGB1

Similar Products

Product Notes

The ITGB1 itgb1 (Catalog #AAA1268579) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaatttac aaccaatttt ctggattgga ctgatcagtt cagtttgctg tgtgtttgct caaacagatg aaaatagatg tttaaaagca aatgccaaat catgtggaga atgtatacaa gcagggccaa attgtgggtg gtgcacaaat tcaacatttt tacaggaagg aatgcctact tctgcacgat gtgatgattt agaagcctta aaaaagaagg gttgccctcc agatgacata gaaaatccca gaggctccaa agatataaag aaaaataaaa atgtaaccaa ccgtagcaaa ggaacagcag agaagctcaa gccagaggat attactcaga tccaaccaca gcagttggtt ttgcgattaa gatcagggga gccacagaca tttacattaa aattcaagag agctgaagac tatcccattg acctctacta ccttatggac ctgtcttact caatgaaaga cgatttggag aatgtaaaaa gtcttggaac agatctgatg aatgaaatga ggaggattac ttcggacttc agaattggat ttggctcatt tgtggaaaag actgtgatgc cttacattag cacaacacca gctaagctca ggaacccttg cacaagtgaa cagaactgca ccagcccatt tagctacaaa aatgtgctca gtcttactaa taaaggagaa gtatttaatg aacttgttgg aaaacagcgc atatctggaa atttggattc tccagaaggt ggtttcgatg ccatcatgca agttgcagtt tgtggatcac tgattggctg gaggaatgtt acacggctgc tggtgttttc cacagatgcc gggtttcact ttgctggaga tgggaaactt ggtggcattg ttttaccaaa tgatggacaa tgtcacctgg aaaataatat gtacacaatg agccattatt atgattatcc ttctattgct caccttgtcc agaaactgag tgaaaataat attcagacaa tttttgcagt tactgaagaa tttcagcctg tttacaagga gctgaaaaac ttgatcccta agtcagcagt aggaacatta tctgcaaatt ctagcaatgt aattcagttg atcattgatg catacaattc cctttcctca gaagtcattt tggaaaacgg caaattgtca gaaggagtaa caataagtta caaatcttac tgcaagaacg gggtgaatgg aacaggggaa aatggaagaa aatgttccaa tatttccatt ggagatgagg ttcaatttga aattagcata acttcaaata agtgtccaaa aaaggattct gacagcttta aaattaggcc tctgggcttt acggaggaag tagaggttat tcttcagtac atctgtgaat gtgaatgcca aagcgaaggc atccctgaaa gtcccaagtg tcatgaagga aatgggacat ttgagtgtgg cgcgtgcagg tgcaatgaag ggcgtgttgg tagacattgt gaatgcagca cagatgaagt taacagtgaa gacatggatg cttactgcag gaaagaaaac agttcagaaa tctgcagtaa caatggagag tgcgtctgcg gacagtgtgt ttgtaggaag agggataata caaatgaaat ttattctggc aaattctgcg agtgtgataa tttcaactgt gatagatcca atggcttaat ttgtggagga aatggtgttt gcaagtgtcg tgtgtgtgag tgcaacccca actacactgg cagtgcatgt gactgttctt tggatactag tacttgtgaa gccagcaacg gacagatctg caatggccgg ggcatctgtg agtgtggtgt ctgtaagtgt acagatccga agtttcaagg gcaaacgtgt gagatgtgtc agacctgcct tggtgtctgt gctgagcata aagaatgtgt tcagtgcaga gccttcaata aaggagaaaa gaaagacaca tgcacacagg aatgttccta ttttaacatt accaaggtag aaagtcggga caaattaccc cagccggtcc aacctgatcc tgtgtcccat tgtaaggaga aggatgttga cgactgttgg ttctatttta cgtattcagt gaatgggaac aacgaggtca tggttcatgt tgtggagaat ccagagtgtc ccactggtcc agacatcatt ccaattgtag ctggtgtggt tgctggaatt gttcttattg gccttgcatt actgctgata tggaagcttt taatgataat tcatgacaga agggagtttg ctaaatttga aaaggagaaa atgaatgcca aatgggacac gggtgaaaat cctatttata agagtgccgt aacaactgtg gtcaatccga agtatgaggg aaaatga. It is sometimes possible for the material contained within the vial of "ITGB1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.