Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ITGAL cdna clone

ITGAL cDNA Clone

Gene Names
ITGAL; CD11A; LFA-1; LFA1A
Synonyms
ITGAL; ITGAL cDNA Clone; ITGAL cdna clone
Ordering
For Research Use Only!
Sequence
atgaaggattcctgcatcactgtgatggccatggcgctgctgtctgggttctttttcttcgcgccggcctcgagctacaacctggacgtgcggggcgcgcggagcttctccccaccgcgcgccgggaggcactttggataccgcgtcctgcaggtcggaaacggggtcatcgtgggagctccaggggaggggaacagcacaggaagcctctatcagtgccagtcgggcacaggacactgcctgccagtcaccctgagaggttccaactatacctccaagtacttgggaatgaccttggcaacagaccccacagatggaagcattttgtttgctgctgttcagttttccacaagctacaaaacagaatttgatttctcagattatgttaaacggaaggaccctgatgctctgctgaagcatgtaaagcacatgttgctgttgaccaatacctttggtgccatcaattatgtcgcgacagaggtgttccgggaggagctgggggcccggccagatgccaccaaagtgcttatcatcatcacggatggggaggccactgacagtggcaacatcgatgcggccaaagacatcatccgctacatcatcgggattggaaagcattttcagaccaaggagagtcaggagaccctccacaaatttgcatcaaaacccgcgagcgagtttgtgaaaattctggacacatttgagaagctgaaagatctattcactgagctgcagaagaagatctatgtcattgagggcacaagcaaacaggacctgacttccttcaacatggagctgtcctccagcggcatcagtgctgacctcagcaggggccatgcagtcgtgggggcagtaggagccaaggactgggctgggggctttcttgacctgaaggcagacctgcaggatgacacatttattgggaatgaaccattgacaccagaagtgagagcaggctatttgggttacaccgtgacctggctgccctcccggcaaaagacttcgttgctggcctcgggagcccctcgataccagcacatgggccgagtgctgctgttccaagagccacagggcggaggacactggagccaggtccagacaatccatgggacccagattggctcttatttcggtggggagctgtgtggcgtcgacgtggaccaagatggggagacagagctgctgctgattggtgccccactgttctatggggagcagagaggaggccgggtgtttatctaccagagaagacagttggggtttgaagaagtctcagagctgcagggggaccccggctacccactcgggcggtttggagaagccatcactgctctgacagacatcaacggcgatgggctggtagacgtggctgtgggggcccctctggaggagcagggggctgtgtacatcttcaatgggaggcacggggggcttagtccccagccaagtcagcggatagaagggacccaagtgctctcaggaattcagtggtttggacgctccatccatggggtgaaggaccttgaaggggatggcttggcagatgtggctgtgggggctgagagccagatgatcgtgctgagctcccggcccgtggtggatatggtcaccctgatgtccttctctccagctgagatcccagtgcatgaagtggagtgctcctattcaaccagtaacaagatgaaagaaggagttaatatcacaatctgtttccagatcaagtctctcatcccccagttccaaggccgcctggttgccaatctcacttacactctgcagctggatggccaccggaccagaagacgggggttgttcccaggagggagacatgaactcagaaggaatatagctgtcaccaccagcatgtcatgcactgacttctcatttcatttcccggtatgtgttcaagacctcatctcccccatcaatgtttccctgaatttctctctttgggaggaggaagggacaccgagggaccaaagggcgggcaaggacataccgcccatcctgagaccctccctgcactcggaaacctgggagatcccttttgagaagaactgtggggaggacaagaagtgtgaggcaaacttgagagtgtccttctctcctgcaagatccagagccctgcgtctaactgcttttgccagcctctctgtggagctgagcctgagtaacttggaagaagatgcttactgggtccagctggacctgcacttccccccgggactctccttccgcaaggtggagatgctgaagccccatagccagatacctgtgagctgcgaggagcttcctgaagagtccaggcttctgtccagggcattatcttgcaatgtgagctctcccatcttcaaagcaggccactcggttgctctgcagatgatgtttaatacactggtaaacagctcctggggggactcggttgaattgcacgccaatgtgacctgtaacaatgaggactcagacctcctggaggacaactcagccactaccatcatccccatcctgtaccccatcaacatcctcatccaggaccaagaagactccacactctatgtcagtttcacccccaaaggccccaagatccaccaagtcaagcacatgtaccaggtgaggatccagccttccatccacgaccacaacatacccaccctggaggctgtggttggggtgccacagcctcccagcgaggggcccatcacacaccagtggagcgtgcagatggagcctcccgtgccctgccactatgaggatctggagaggctcccggatgcagctgagccttgtctccccggagccctgttccgctgccctgttgtcttcaggcaggagatcctcgtccaagtgatcgggactctggagctggtgggagagatcgaggcctcttccatgttcagcctctgcagctccctctccatctccttcaacagcagcaagcatttccacctctatggcagcaacgcctccctggcccaggttgtcatgaaggttgacgtggtgtatgagaagcagatgctctacctctacgtgctgagcggcatcggggggctgctgctgctgctgctcattttcatagtgctgtacaaggttggtttcttcaaacggaacctgaaggagaagatggaggctggcagaggtgtcccgaatggaatccctgcagaagactctgagcagctggcatctgggcaagaggctggggatcccggctgcctgaagcccctccatgagaaggactctgagagtggtggtggcaaggactga
Sequence Length
3261
Vector
pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
119,224 Da
NCBI Official Full Name
Homo sapiens integrin, alpha L (antigen CD11A (p180), lymphocyte function-associated antigen 1; alpha polypeptide), mRNA
NCBI Official Synonym Full Names
integrin subunit alpha L
NCBI Official Symbol
ITGAL
NCBI Official Synonym Symbols
CD11A; LFA-1; LFA1A
NCBI Protein Information
integrin alpha-L
UniProt Protein Name
Integrin alpha-L
Protein Family
UniProt Gene Name
ITGAL
UniProt Synonym Gene Names
CD11A; LFA-1A
UniProt Entry Name
ITAL_HUMAN

NCBI Description

ITGAL encodes the integrin alpha L chain. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This I-domain containing alpha integrin combines with the beta 2 chain (ITGB2) to form the integrin lymphocyte function-associated antigen-1 (LFA-1), which is expressed on all leukocytes. LFA-1 plays a central role in leukocyte intercellular adhesion through interactions with its ligands, ICAMs 1-3 (intercellular adhesion molecules 1 through 3), and also functions in lymphocyte costimulatory signaling. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

ITGAL: Integrin alpha-L/beta-2 is a receptor for ICAM1, ICAM2, ICAM3 and ICAM4. It is involved in a variety of immune phenomena including leukocyte-endothelial cell interaction, cytotoxic T-cell mediated killing, and antibody dependent killing by granulocytes and monocytes. Belongs to the integrin alpha chain family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Cell surface; Cell adhesion; Membrane protein, integral; Motility/polarity/chemotaxis

Chromosomal Location of Human Ortholog: 16p11.2

Cellular Component: cell surface; membrane; plasma membrane

Molecular Function: cell adhesion molecule binding; ICAM-3 receptor activity; protein binding

Biological Process: cell motility; cell-matrix adhesion; extracellular matrix organization and biogenesis; heterophilic cell adhesion; leukocyte adhesion; leukocyte migration; receptor clustering; regulation of immune response; T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell

Research Articles on ITGAL

Similar Products

Product Notes

The ITGAL itgal (Catalog #AAA1276150) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaaggatt cctgcatcac tgtgatggcc atggcgctgc tgtctgggtt ctttttcttc gcgccggcct cgagctacaa cctggacgtg cggggcgcgc ggagcttctc cccaccgcgc gccgggaggc actttggata ccgcgtcctg caggtcggaa acggggtcat cgtgggagct ccaggggagg ggaacagcac aggaagcctc tatcagtgcc agtcgggcac aggacactgc ctgccagtca ccctgagagg ttccaactat acctccaagt acttgggaat gaccttggca acagacccca cagatggaag cattttgttt gctgctgttc agttttccac aagctacaaa acagaatttg atttctcaga ttatgttaaa cggaaggacc ctgatgctct gctgaagcat gtaaagcaca tgttgctgtt gaccaatacc tttggtgcca tcaattatgt cgcgacagag gtgttccggg aggagctggg ggcccggcca gatgccacca aagtgcttat catcatcacg gatggggagg ccactgacag tggcaacatc gatgcggcca aagacatcat ccgctacatc atcgggattg gaaagcattt tcagaccaag gagagtcagg agaccctcca caaatttgca tcaaaacccg cgagcgagtt tgtgaaaatt ctggacacat ttgagaagct gaaagatcta ttcactgagc tgcagaagaa gatctatgtc attgagggca caagcaaaca ggacctgact tccttcaaca tggagctgtc ctccagcggc atcagtgctg acctcagcag gggccatgca gtcgtggggg cagtaggagc caaggactgg gctgggggct ttcttgacct gaaggcagac ctgcaggatg acacatttat tgggaatgaa ccattgacac cagaagtgag agcaggctat ttgggttaca ccgtgacctg gctgccctcc cggcaaaaga cttcgttgct ggcctcggga gcccctcgat accagcacat gggccgagtg ctgctgttcc aagagccaca gggcggagga cactggagcc aggtccagac aatccatggg acccagattg gctcttattt cggtggggag ctgtgtggcg tcgacgtgga ccaagatggg gagacagagc tgctgctgat tggtgcccca ctgttctatg gggagcagag aggaggccgg gtgtttatct accagagaag acagttgggg tttgaagaag tctcagagct gcagggggac cccggctacc cactcgggcg gtttggagaa gccatcactg ctctgacaga catcaacggc gatgggctgg tagacgtggc tgtgggggcc cctctggagg agcagggggc tgtgtacatc ttcaatggga ggcacggggg gcttagtccc cagccaagtc agcggataga agggacccaa gtgctctcag gaattcagtg gtttggacgc tccatccatg gggtgaagga ccttgaaggg gatggcttgg cagatgtggc tgtgggggct gagagccaga tgatcgtgct gagctcccgg cccgtggtgg atatggtcac cctgatgtcc ttctctccag ctgagatccc agtgcatgaa gtggagtgct cctattcaac cagtaacaag atgaaagaag gagttaatat cacaatctgt ttccagatca agtctctcat cccccagttc caaggccgcc tggttgccaa tctcacttac actctgcagc tggatggcca ccggaccaga agacgggggt tgttcccagg agggagacat gaactcagaa ggaatatagc tgtcaccacc agcatgtcat gcactgactt ctcatttcat ttcccggtat gtgttcaaga cctcatctcc cccatcaatg tttccctgaa tttctctctt tgggaggagg aagggacacc gagggaccaa agggcgggca aggacatacc gcccatcctg agaccctccc tgcactcgga aacctgggag atcccttttg agaagaactg tggggaggac aagaagtgtg aggcaaactt gagagtgtcc ttctctcctg caagatccag agccctgcgt ctaactgctt ttgccagcct ctctgtggag ctgagcctga gtaacttgga agaagatgct tactgggtcc agctggacct gcacttcccc ccgggactct ccttccgcaa ggtggagatg ctgaagcccc atagccagat acctgtgagc tgcgaggagc ttcctgaaga gtccaggctt ctgtccaggg cattatcttg caatgtgagc tctcccatct tcaaagcagg ccactcggtt gctctgcaga tgatgtttaa tacactggta aacagctcct ggggggactc ggttgaattg cacgccaatg tgacctgtaa caatgaggac tcagacctcc tggaggacaa ctcagccact accatcatcc ccatcctgta ccccatcaac atcctcatcc aggaccaaga agactccaca ctctatgtca gtttcacccc caaaggcccc aagatccacc aagtcaagca catgtaccag gtgaggatcc agccttccat ccacgaccac aacataccca ccctggaggc tgtggttggg gtgccacagc ctcccagcga ggggcccatc acacaccagt ggagcgtgca gatggagcct cccgtgccct gccactatga ggatctggag aggctcccgg atgcagctga gccttgtctc cccggagccc tgttccgctg ccctgttgtc ttcaggcagg agatcctcgt ccaagtgatc gggactctgg agctggtggg agagatcgag gcctcttcca tgttcagcct ctgcagctcc ctctccatct ccttcaacag cagcaagcat ttccacctct atggcagcaa cgcctccctg gcccaggttg tcatgaaggt tgacgtggtg tatgagaagc agatgctcta cctctacgtg ctgagcggca tcggggggct gctgctgctg ctgctcattt tcatagtgct gtacaaggtt ggtttcttca aacggaacct gaaggagaag atggaggctg gcagaggtgt cccgaatgga atccctgcag aagactctga gcagctggca tctgggcaag aggctgggga tcccggctgc ctgaagcccc tccatgagaa ggactctgag agtggtggtg gcaaggactg a. It is sometimes possible for the material contained within the vial of "ITGAL, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.