Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ITGA2B cdna clone

ITGA2B cDNA Clone

Gene Names
ITGA2B; GT; GTA; CD41; GP2B; HPA3; CD41B; GPIIb; BDPLT2; BDPLT16; PPP1R93
Synonyms
ITGA2B; ITGA2B cDNA Clone; ITGA2B cdna clone
Ordering
For Research Use Only!
Sequence
atggccagagctttgtgtccactgcaagccctctggcttctggagtgggtgctgctgctcttgggaccttgtgctgcccctccagcctgggccttgaacctggacccagtgcagctcaccttctatgcaggccccaatggcagccagtttggattttcactggacttccacaaggacagccatgggagagtggccatcgtggtgggcgccccgcggaccctgggccccagccaggaggagacgggcggcgtgttcctgtgcccctggagggccgagggcggccagtgcccctcgctgctctttgacctccgtgatgagacccgaaatgtaggctcccaaactttacaaaccttcaaggcccgccaaggactgggggcgtcggtcgtcagctggagcgacgtcattgtggcctgcgccccctggcagcactggaacgtcctagaaaagactgaggaggctgagaagacgcccgtaggtagctgctttttggctcagccagagagcggccgccgcgccgagtactccccctgtcgcgggaacaccctgagccgcatttacgtggaaaatgattttagctgggacaagcgttactgtgaagcgggcttcagctccgtggtcactcaggccggagagctggtgcttggggctcctggcggctattatttcttaggtctcctggcccaggctccagttgcggatattttctcgagttaccgcccaggcatccttttgtggcacgtgtcctcccagagcctctcctttgactccagcaacccagagtacttcgacggctactgggggtactcggtggccgtgggcgagttcgacggggatctcaacactacagaatatgtcgtcggtgcccccacttggagctggaccctgggagcggtggaaattttggattcctactaccagaggctgcatcggctgcgcggagagcagatggcgtcgtattttgggcattcagtggctgtcactgacgtcaacggggatgggaggcatgatctgctggtgggcgctccactgtatatggagagccgggcagaccgaaaactggccgaagtggggcgtgtgtatttgttcctgcagccgcgaggcccccacgcgctgggtgcccccagcctcctgctgactggcacacagctctatgggcgattcggctctgccatcgcacccctgggcgacctcgaccgggatggctacaatgacattgcagtggctgccccctacgggggtcccagtggccggggccaagtgctggtgttcctgggtcagagtgaggggctgaggtcacgtccctcccaggtcctggacagccccttccccacaggctctgcctttggcttctcccttcgaggtgccgtagacatcgatgacaacggatacccagacctgatcgtgggagcttacggggccaaccaggtggctgtgtacagagctcagccagtggtgaaggcctctgtccagctactggtgcaagattcactgaatcctgctgtgaagagctgtgtcctacctcagaccaagacacccgtgagctgcttcaacatccagatgtgtgttggagccactgggcacaacattcctcagaagctatccctaaatgccgagctgcagctggaccggcagaagccccgccagggccggcgggtgctgctgctgggctctcaacaggcaggcaccaccctgaacctggatctgggcggaaagcacagccccatctgccacaccaccatggccttccttcgagatgaggcagacttccgggacaagctgagccccattgtgctcagcctcaatgtgtccctaccgcccacggaggctggaatggcccctgctgtcgtgctgcatggagacacccatgtgcaggagcagacacgaatcgtcctggactgtggggaagatgacgtatgtgtgccccagcttcagctcactgccagcgtgacgggctccccgctcctagttggggcagataatgtcctggagctgcagatggacgcagccaacgagggcgagggggcctatgaagcagagctggccgtgcacctgccccagggcgcccactacatgcgggccctaagcaatgtcgagggctttgagagactcatctgtaatcagaagaaggagaatgagaccagggtggtgctgtgtgagctgggcaaccccatgaagaagaacgcccagataggaatcgcgatgttggtgagcgtggggaatctggaagaggctggggagtctgtgtccttccagctgcagatacggagcaagaacagccagaatccaaacagcaagattgtgctgctggacgtgccggtccgggcagaggcccaagtggagctgcgagggaactcctttccagcctccctggtggtggcagcagaagaaggtgagagggagcagaacagcttggacagctggggacccaaagtggagcacacctatgagctccacaacaatggccctgggactgtgaatggtcttcacctcagcatccaccttccgggacagtcccagccctccgacctgctctacatcctggatatacagccccaggggggccttcagtgcttcccacagcctcctgtcaaccctctcaaggtggactgggggctgcccatccccagcccctcccccattcacccggcccatcacaagcgggatcgcagacagatcttcctgccagagcccgagcagccctcgaggcttcaggatccagttctcgtaagctgcgactcggcgccctgtactgtggtgcagtgtgacctgcaggagatggcgcgcgggcagcgggccatggtcacggtgctggccttcctgtggctgcccagcctctaccagaggcctctggatcagtttgtgctgcagtcgcacgcatggttcaacgtgtcctccctcccctatgcggtgcccccgctcagcctgccccgaggggaagctcaggtgtggacacagctgctccgggccttggaggagagggccattccaatctggtgggtgctggtgggtgtgctgggtggcctgctgctgctcaccatcctggtcctggccatgtggaaggtcggcttcttcaagcggaaccggccacccctggaagaagatgatgaagagggggagtga
Sequence Length
3120
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
103,218 Da
NCBI Official Full Name
Homo sapiens integrin, alpha 2b (platelet glycoprotein IIb of IIb/IIIa complex, antigen CD41), mRNA
NCBI Official Synonym Full Names
integrin subunit alpha 2b
NCBI Official Symbol
ITGA2B
NCBI Official Synonym Symbols
GT; GTA; CD41; GP2B; HPA3; CD41B; GPIIb; BDPLT2; BDPLT16; PPP1R93
NCBI Protein Information
integrin alpha-IIb
UniProt Protein Name
Integrin alpha-IIb
Protein Family
UniProt Gene Name
ITGA2B
UniProt Synonym Gene Names
GP2B; ITGAB; GPIIb
UniProt Entry Name
ITA2B_HUMAN

NCBI Description

This gene encodes a member of the integrin alpha chain family of proteins. The encoded preproprotein is proteolytically processed to generate light and heavy chains that associate through disulfide linkages to form a subunit of the alpha-IIb/beta-3 integrin cell adhesion receptor. This receptor plays a crucial role in the blood coagulation system, by mediating platelet aggregation. Mutations in this gene are associated with platelet-type bleeding disorders, which are characterized by a failure of platelet aggregation, including Glanzmann thrombasthenia. [provided by RefSeq, Jan 2016]

Uniprot Description

ITGA2B: Integrin alpha-IIb/beta-3 is a receptor for fibronectin, fibrinogen, plasminogen, prothrombin, thrombospondin and vitronectin. It recognizes the sequence R-G-D in a wide array of ligands. It recognizes the sequence H-H-L-G-G-G-A-K-Q-A-G-D-V in fibrinogen gamma chain. Following activation integrin alpha- IIb/beta-3 brings about platelet/platelet interaction through binding of soluble fibrinogen. This step leads to rapid platelet aggregation which physically plugs ruptured endothelial cell surface. Belongs to the integrin alpha chain family. Heterodimer of an alpha and a beta subunit. The alpha subunit is composed of an heavy and a light chain linked by a disulfide bond. Alpha-IIb associates with beta-3. Directly interacts with RNF181. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Cell adhesion; Membrane protein, integral; Motility/polarity/chemotaxis

Chromosomal Location of Human Ortholog: 17q21.32

Cellular Component: cell surface; integral to plasma membrane; plasma membrane; platelet alpha granule membrane

Molecular Function: identical protein binding; protein binding

Biological Process: cell adhesion; extracellular matrix organization and biogenesis; integrin-mediated signaling pathway; platelet degranulation

Disease: Bleeding Disorder, Platelet-type, 16; Glanzmann Thrombasthenia

Research Articles on ITGA2B

Similar Products

Product Notes

The ITGA2B itga2b (Catalog #AAA1273592) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccagag ctttgtgtcc actgcaagcc ctctggcttc tggagtgggt gctgctgctc ttgggacctt gtgctgcccc tccagcctgg gccttgaacc tggacccagt gcagctcacc ttctatgcag gccccaatgg cagccagttt ggattttcac tggacttcca caaggacagc catgggagag tggccatcgt ggtgggcgcc ccgcggaccc tgggccccag ccaggaggag acgggcggcg tgttcctgtg cccctggagg gccgagggcg gccagtgccc ctcgctgctc tttgacctcc gtgatgagac ccgaaatgta ggctcccaaa ctttacaaac cttcaaggcc cgccaaggac tgggggcgtc ggtcgtcagc tggagcgacg tcattgtggc ctgcgccccc tggcagcact ggaacgtcct agaaaagact gaggaggctg agaagacgcc cgtaggtagc tgctttttgg ctcagccaga gagcggccgc cgcgccgagt actccccctg tcgcgggaac accctgagcc gcatttacgt ggaaaatgat tttagctggg acaagcgtta ctgtgaagcg ggcttcagct ccgtggtcac tcaggccgga gagctggtgc ttggggctcc tggcggctat tatttcttag gtctcctggc ccaggctcca gttgcggata ttttctcgag ttaccgccca ggcatccttt tgtggcacgt gtcctcccag agcctctcct ttgactccag caacccagag tacttcgacg gctactgggg gtactcggtg gccgtgggcg agttcgacgg ggatctcaac actacagaat atgtcgtcgg tgcccccact tggagctgga ccctgggagc ggtggaaatt ttggattcct actaccagag gctgcatcgg ctgcgcggag agcagatggc gtcgtatttt gggcattcag tggctgtcac tgacgtcaac ggggatggga ggcatgatct gctggtgggc gctccactgt atatggagag ccgggcagac cgaaaactgg ccgaagtggg gcgtgtgtat ttgttcctgc agccgcgagg cccccacgcg ctgggtgccc ccagcctcct gctgactggc acacagctct atgggcgatt cggctctgcc atcgcacccc tgggcgacct cgaccgggat ggctacaatg acattgcagt ggctgccccc tacgggggtc ccagtggccg gggccaagtg ctggtgttcc tgggtcagag tgaggggctg aggtcacgtc cctcccaggt cctggacagc cccttcccca caggctctgc ctttggcttc tcccttcgag gtgccgtaga catcgatgac aacggatacc cagacctgat cgtgggagct tacggggcca accaggtggc tgtgtacaga gctcagccag tggtgaaggc ctctgtccag ctactggtgc aagattcact gaatcctgct gtgaagagct gtgtcctacc tcagaccaag acacccgtga gctgcttcaa catccagatg tgtgttggag ccactgggca caacattcct cagaagctat ccctaaatgc cgagctgcag ctggaccggc agaagccccg ccagggccgg cgggtgctgc tgctgggctc tcaacaggca ggcaccaccc tgaacctgga tctgggcgga aagcacagcc ccatctgcca caccaccatg gccttccttc gagatgaggc agacttccgg gacaagctga gccccattgt gctcagcctc aatgtgtccc taccgcccac ggaggctgga atggcccctg ctgtcgtgct gcatggagac acccatgtgc aggagcagac acgaatcgtc ctggactgtg gggaagatga cgtatgtgtg ccccagcttc agctcactgc cagcgtgacg ggctccccgc tcctagttgg ggcagataat gtcctggagc tgcagatgga cgcagccaac gagggcgagg gggcctatga agcagagctg gccgtgcacc tgccccaggg cgcccactac atgcgggccc taagcaatgt cgagggcttt gagagactca tctgtaatca gaagaaggag aatgagacca gggtggtgct gtgtgagctg ggcaacccca tgaagaagaa cgcccagata ggaatcgcga tgttggtgag cgtggggaat ctggaagagg ctggggagtc tgtgtccttc cagctgcaga tacggagcaa gaacagccag aatccaaaca gcaagattgt gctgctggac gtgccggtcc gggcagaggc ccaagtggag ctgcgaggga actcctttcc agcctccctg gtggtggcag cagaagaagg tgagagggag cagaacagct tggacagctg gggacccaaa gtggagcaca cctatgagct ccacaacaat ggccctggga ctgtgaatgg tcttcacctc agcatccacc ttccgggaca gtcccagccc tccgacctgc tctacatcct ggatatacag ccccaggggg gccttcagtg cttcccacag cctcctgtca accctctcaa ggtggactgg gggctgccca tccccagccc ctcccccatt cacccggccc atcacaagcg ggatcgcaga cagatcttcc tgccagagcc cgagcagccc tcgaggcttc aggatccagt tctcgtaagc tgcgactcgg cgccctgtac tgtggtgcag tgtgacctgc aggagatggc gcgcgggcag cgggccatgg tcacggtgct ggccttcctg tggctgccca gcctctacca gaggcctctg gatcagtttg tgctgcagtc gcacgcatgg ttcaacgtgt cctccctccc ctatgcggtg cccccgctca gcctgccccg aggggaagct caggtgtgga cacagctgct ccgggccttg gaggagaggg ccattccaat ctggtgggtg ctggtgggtg tgctgggtgg cctgctgctg ctcaccatcc tggtcctggc catgtggaag gtcggcttct tcaagcggaa ccggccaccc ctggaagaag atgatgaaga gggggagtga. It is sometimes possible for the material contained within the vial of "ITGA2B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.