ISYNA1 cdna clone

ISYNA1 cDNA Clone

Gene Names

ISYNA1; IPS; INO1; INOS; IPS 1; IPS-1

Synonyms

ISYNA1; ISYNA1 cDNA Clone; ISYNA1 cdna clone

Ordering
Cat. Num. AAA1273328 For Research Use Only!

Sequence

atggaggccgccgcccagttcttcgtcgagagcccggacgtggtctacggccccgaggccatcgaggcgcaatacgagtaccggacgacgcgcgtcagccgcgagggtggcgttctcaaggtgcaccccacgtccacgcgcttcaccttccggaccgcccggcaggtgccccggctcggggtcatgcttgtcggctggggcgggaacaacggctccacactcaccgccgcggtgctggccaatcgactgcgtttgtcctggcccacgcgcagcggccgcaaggaggccaactactacggctcgctgactcaggcgggcaccgtgagcctgggcctggacgccgagggccaggaggtgttcgtacccttcagcgcggtgctgcccatggtggcgcccaacgacctcgtgttcgatggctgggacatctcgtcgctgaacctggccgaggcgatgcggcgcgcgaaggtgctggactgggggctgcaggagcaactgtggccgcacatggaggccctgcggccccggccttctgtttacatccccgaattcatcgcggccaaccagagcgcgcgcgcggacaacctcatcccaggctcgcgtgcgcagcagctggagcagatccgcagggacatccgagacttccggtctagcgcggggctggacaaagtcatagtgctgtggacggcgaacacggagcgcttctgtgaggtgattccaggcctcaacgacacagccgagaacctgctgcgcaccattgagctcggtctggaggtgtcgccctccacgctcttcgccgtggccagcatcctggagggctgtgccttcctcaatgggtctccgcagaacaccctggtgcccggagctcttgagctcgcgtggcagcaccgggtttttgtgggcggagatgacttcaagtcaggccagaccaaagtcaagtccgtgcttgtggacttcctcattggctccggcctcaagaccatgtccatcgtgagttacaaccacctgggcaacaacgatggggagaacctatcggcgccattgcagttccgctctaaggaggtgtccaagagcaacgtggtggacgacatggtgcagagcaacccagtgctctatacgcccggcgaagagcctgaccactgcgtggtcatcaagtatgtgccgtacgtgggtgacagcaagcgcgcgctggatgagtatacctcggagctgatgctgggcggaaccaacacactggtgctgcacaacacgtgtgaggactcgctgctggccgcacccatcatgctggacctagcgctgctgaccgagctgtgccagcgcgtgagcttctgcactgacatggaccccgagccgcagaccttccaccccgtgctgtccctgctcagcttcctcttcaaggcgccactagtgccgcccggcagcccggtggtcaatgcgcttttccgccagcgcagctgcatcgagaacatcctcagggcctgcgtggggctcccgccacagaaccacatgctcctggaacacaaaatggagcgcccagggcccagcctcaagcgagttggacccgtggctgccacctaccctatgttgaacaagaaaggaccggtacccgctgccaccaatggctgcaccggtgatgccaatgggcatctgcaagaggagcccccaatgcccaccacctga

Sequence Length

1677

Vector

Please Inquire

NCBI and Uniprot Product Information

NCBI GI #

39644645

NCBI GeneID

51477

Molecular Weight

55,136 Da

NCBI Official Full Name

Homo sapiens inositol-3-phosphate synthase 1, mRNA

NCBI Official Synonym Full Names

inositol-3-phosphate synthase 1

NCBI Official Symbol

ISYNA1

NCBI Official Synonym Symbols

IPS; INO1; INOS; IPS 1; IPS-1

NCBI Protein Information

inositol-3-phosphate synthase 1

UniProt Protein Name

Inositol-3-phosphate synthase 1

Protein Family

Inositol-3-phosphate synthase

UniProt Gene Name

ISYNA1

UniProt Synonym Gene Names

INO1; IPS 1; MI-1-P synthase; MIP synthase; hIPS; hINO1

UniProt Entry Name

INO1_HUMAN

NCBI Description

This gene encodes an inositol-3-phosphate synthase enzyme. The encoded protein plays a critical role in the myo-inositol biosynthesis pathway by catalyzing the rate-limiting conversion of glucose 6-phosphate to myoinositol 1-phosphate. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the short arm of chromosome 4. [provided by RefSeq, Nov 2011]

Uniprot Description

ISYNA1: Key enzyme in myo-inositol biosynthesis pathway that catalyzes the conversion of glucose 6-phosphate to 1-myo-inositol 1-phosphate in a NAD-dependent manner. Rate-limiting enzyme in the synthesis of all inositol-containing compounds. Belongs to the myo-inositol 1-phosphate synthase family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Carbohydrate Metabolism - inositol phosphate; Isomerase; EC 5.5.1.4

Chromosomal Location of Human Ortholog: 19p13.11

Cellular Component: cytosol

Molecular Function: inositol-3-phosphate synthase activity; protein binding

Biological Process: inositol phosphate metabolic process

Research Articles on ISYNA1

1. analysis of how myo-inositol-3-phosphate synthase is regulated by phosphorylation

Similar Products

Product Notes

The ISYNA1 isyna1 (Catalog #AAA1273328) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaggccg ccgcccagtt cttcgtcgag agcccggacg tggtctacgg ccccgaggcc atcgaggcgc aatacgagta ccggacgacg cgcgtcagcc gcgagggtgg cgttctcaag gtgcacccca cgtccacgcg cttcaccttc cggaccgccc ggcaggtgcc ccggctcggg gtcatgcttg tcggctgggg cgggaacaac ggctccacac tcaccgccgc ggtgctggcc aatcgactgc gtttgtcctg gcccacgcgc agcggccgca aggaggccaa ctactacggc tcgctgactc aggcgggcac cgtgagcctg ggcctggacg ccgagggcca ggaggtgttc gtacccttca gcgcggtgct gcccatggtg gcgcccaacg acctcgtgtt cgatggctgg gacatctcgt cgctgaacct ggccgaggcg atgcggcgcg cgaaggtgct ggactggggg ctgcaggagc aactgtggcc gcacatggag gccctgcggc cccggccttc tgtttacatc cccgaattca tcgcggccaa ccagagcgcg cgcgcggaca acctcatccc aggctcgcgt gcgcagcagc tggagcagat ccgcagggac atccgagact tccggtctag cgcggggctg gacaaagtca tagtgctgtg gacggcgaac acggagcgct tctgtgaggt gattccaggc ctcaacgaca cagccgagaa cctgctgcgc accattgagc tcggtctgga ggtgtcgccc tccacgctct tcgccgtggc cagcatcctg gagggctgtg ccttcctcaa tgggtctccg cagaacaccc tggtgcccgg agctcttgag ctcgcgtggc agcaccgggt ttttgtgggc ggagatgact tcaagtcagg ccagaccaaa gtcaagtccg tgcttgtgga cttcctcatt ggctccggcc tcaagaccat gtccatcgtg agttacaacc acctgggcaa caacgatggg gagaacctat cggcgccatt gcagttccgc tctaaggagg tgtccaagag caacgtggtg gacgacatgg tgcagagcaa cccagtgctc tatacgcccg gcgaagagcc tgaccactgc gtggtcatca agtatgtgcc gtacgtgggt gacagcaagc gcgcgctgga tgagtatacc tcggagctga tgctgggcgg aaccaacaca ctggtgctgc acaacacgtg tgaggactcg ctgctggccg cacccatcat gctggaccta gcgctgctga ccgagctgtg ccagcgcgtg agcttctgca ctgacatgga ccccgagccg cagaccttcc accccgtgct gtccctgctc agcttcctct tcaaggcgcc actagtgccg cccggcagcc cggtggtcaa tgcgcttttc cgccagcgca gctgcatcga gaacatcctc agggcctgcg tggggctccc gccacagaac cacatgctcc tggaacacaa aatggagcgc ccagggccca gcctcaagcg agttggaccc gtggctgcca cctaccctat gttgaacaag aaaggaccgg tacccgctgc caccaatggc tgcaccggtg atgccaatgg gcatctgcaa gaggagcccc caatgcccac cacctga. It is sometimes possible for the material contained within the vial of "ISYNA1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Loading...

ISYNA1 cdna clone