Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

IRAK4 cdna clone

IRAK4 cDNA Clone

Gene Names
IRAK4; IPD1; REN64; IRAK-4; NY-REN-64
Synonyms
IRAK4; IRAK4 cDNA Clone; IRAK4 cdna clone
Ordering
For Research Use Only!
Sequence
atgaacaaacccataacaccatcaacatatgtgcgctgcctcaatgttggactaattaggaagctgtcagattttattgatcctcaagaaggatggaagaagttagctgtagctattaaaaaaccatctggtgatgatagatacaatcagtttcacataaggagatttgaagcattacttcaaactggaaaaagtcccacttctgaattactgtttgactggggcaccacaaattgcacagttggtgatcttgtggatcttttgatccaaaatgaattttttgctcctgcaagtcttttgctcccagatgctgttcccaaaactgctaatacactaccttctaaagaagctataacagttcagcaaaaacagatgcctttctgtgacaaagacaggacattgatgacacctgtgcagaatcttgaacaaagctatatgccacctgactcctcaagtccagaaaataaaagtttagaagttagtgatacacgttttcacagtttttcattttatgaattgaagaatgtcacaaataactttgatgaacgacccatttctgttggtggtaataaaatgggagagggaggatttggagttgtatataaaggctacgtaaataacacaactgtggcagtgaagaagcttgcagcaatggttgacattactactgaagaactgaaacagcagtttgatcaagaaataaaagtaatggcaaagtgtcaacatgaaaacttagtagaactacttggtttctcaagtgatggagatgacctctgcttagtatatgtttacatgcctaatggttcattgctagacagactctcttgcttggatggtactccaccactttcttggcacatgagatgcaagattgctcagggtgcagctaatggcatcaattttctacatgaaaatcatcatattcatagagatattaaaagtgcaaatatcttactggatgaagcttttactgctaaaatatctgactttggccttgcacgggcttctgagaagtttgcccagacagtcatgactagcagaattgtgggaacaacagcttatatggcaccagaagctttgcgtggagaaataacacccaaatctgatatttacagctttggtgtggttttactagaaataataactggacttccagctgtggatgaacaccgtgaacctcagttattgctagatattaaagaagaaattgaagatgaagaaaagacaattgaagattatattgataaaaagatgaatgatgctgattccacttcagttgaagctatgtactctgttgctagtcaatgtctgcatgaaaagaaaaataagagaccagacattaagaaggttcaacagctgctgcaagagatgacagcttcttaa
Sequence Length
1383
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
37,674 Da
NCBI Official Full Name
Homo sapiens interleukin-1 receptor-associated kinase 4, mRNA
NCBI Official Synonym Full Names
interleukin 1 receptor associated kinase 4
NCBI Official Symbol
IRAK4
NCBI Official Synonym Symbols
IPD1; REN64; IRAK-4; NY-REN-64
NCBI Protein Information
interleukin-1 receptor-associated kinase 4
UniProt Protein Name
Interleukin-1 receptor-associated kinase 4
UniProt Gene Name
IRAK4
UniProt Synonym Gene Names
IRAK-4
UniProt Entry Name
IRAK4_HUMAN

NCBI Description

This gene encodes a kinase that activates NF-kappaB in both the Toll-like receptor (TLR) and T-cell receptor (TCR) signaling pathways. The protein is essential for most innate immune responses. Mutations in this gene result in IRAK4 deficiency and recurrent invasive pneumococcal disease. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]

Uniprot Description

IRAK4: a TKL kinase of the IRAK family. The interleukin-1 receptor-associated kinases are important mediators in the signal transduction of Toll-like receptor and IL1R family members, collectively referred to as TIRs.

Protein type: Kinase, protein; Protein kinase, Ser/Thr (non-receptor); Protein kinase, TKL; EC 2.7.11.1; TKL group; IRAK family

Chromosomal Location of Human Ortholog: 12q12

Cellular Component: cytoplasm; cytosol; endosome membrane; nucleus; plasma membrane

Molecular Function: protein binding; protein kinase activity; protein serine/threonine kinase activity

Biological Process: innate immune response; MyD88-dependent toll-like receptor signaling pathway; neutrophil mediated immunity; positive regulation of I-kappaB kinase/NF-kappaB cascade; toll-like receptor 9 signaling pathway; toll-like receptor signaling pathway

Disease: Invasive Pneumococcal Disease, Recurrent Isolated, 1; Irak4 Deficiency

Research Articles on IRAK4

Similar Products

Product Notes

The IRAK4 irak4 (Catalog #AAA1270732) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaacaaac ccataacacc atcaacatat gtgcgctgcc tcaatgttgg actaattagg aagctgtcag attttattga tcctcaagaa ggatggaaga agttagctgt agctattaaa aaaccatctg gtgatgatag atacaatcag tttcacataa ggagatttga agcattactt caaactggaa aaagtcccac ttctgaatta ctgtttgact ggggcaccac aaattgcaca gttggtgatc ttgtggatct tttgatccaa aatgaatttt ttgctcctgc aagtcttttg ctcccagatg ctgttcccaa aactgctaat acactacctt ctaaagaagc tataacagtt cagcaaaaac agatgccttt ctgtgacaaa gacaggacat tgatgacacc tgtgcagaat cttgaacaaa gctatatgcc acctgactcc tcaagtccag aaaataaaag tttagaagtt agtgatacac gttttcacag tttttcattt tatgaattga agaatgtcac aaataacttt gatgaacgac ccatttctgt tggtggtaat aaaatgggag agggaggatt tggagttgta tataaaggct acgtaaataa cacaactgtg gcagtgaaga agcttgcagc aatggttgac attactactg aagaactgaa acagcagttt gatcaagaaa taaaagtaat ggcaaagtgt caacatgaaa acttagtaga actacttggt ttctcaagtg atggagatga cctctgctta gtatatgttt acatgcctaa tggttcattg ctagacagac tctcttgctt ggatggtact ccaccacttt cttggcacat gagatgcaag attgctcagg gtgcagctaa tggcatcaat tttctacatg aaaatcatca tattcataga gatattaaaa gtgcaaatat cttactggat gaagctttta ctgctaaaat atctgacttt ggccttgcac gggcttctga gaagtttgcc cagacagtca tgactagcag aattgtggga acaacagctt atatggcacc agaagctttg cgtggagaaa taacacccaa atctgatatt tacagctttg gtgtggtttt actagaaata ataactggac ttccagctgt ggatgaacac cgtgaacctc agttattgct agatattaaa gaagaaattg aagatgaaga aaagacaatt gaagattata ttgataaaaa gatgaatgat gctgattcca cttcagttga agctatgtac tctgttgcta gtcaatgtct gcatgaaaag aaaaataaga gaccagacat taagaaggtt caacagctgc tgcaagagat gacagcttct taa. It is sometimes possible for the material contained within the vial of "IRAK4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.