Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

INTS12 cdna clone

INTS12 cDNA Clone

Gene Names
INTS12; INT12; PHF22; SBBI22
Synonyms
INTS12; INTS12 cDNA Clone; INTS12 cdna clone
Ordering
For Research Use Only!
Sequence
atggctgctactgtgaacttggaacttgatcccatttttttgaaagcactaggtttcttgcattcaaagagtaaagattctgctgaaaagctaaaagcactgcttgatgaatctttggctcggggcattgattccagttaccgtccatctcaaaaggatgtggagccacccaaaatttcaagcacaaaaaacatttccattaagcaagagcccaaaatatcatccagtcttccttctggtaataataatggcaaggtcctcacaactgaaaaggtaaagaaggaagctgaaaagagacctgctgataaaatgaaatcagacatcactgaaggagttgatattccaaagaaacctagattggagaaaccagaaacacagtcatctcccattactgtccaaagtagcaaggatttacctatggctgacctttccagttttgaggagaccagtgctgatgattttgccatggagatgggattggcctgcgttgtttgtaggcaaatgatggtggcatctggcaatcaattagtagaatgtcaggagtgccataatctctaccaccgagattgtcataaaccccaggtgacagacaaggaagcgaatgaccctcgcctggtgtggtattgtgcccgatgtaccagacaaatgaaaagaatggctcaaaaaactcagaaaccaccgcagaaaccagcccctgcagttgtttctgtaactccagctgtcaaagatccattggttaagaaaccagaaactaaactgaaacaagagacaacttttctagcgtttaagagaacagaagtcaagacatccacagttatttcaggaaattcttctagtgccagcgtttcctcgtcagtaactagtggcttaactggatgggcagcttttgcagccaaaacttcctctgctggtccttcaacagcaaaattgagttcaacaacacaaaacaatactgggaaacctgctacttcgtcagctaaccagaaacctgtgggtttgactggtctggcaacatcatccaaaggtggaataggttccaaaataggttccaataacagcactacgcccactgtacctttaaaaccacctccacctctaaccttgggtaaaactggccttagtcgctcagttagttgtgacaatgtcagcaaagtaggtcttcctagtccaagtagtttagttccaggaagcagcagccaactaagtgggaatggaaatagtggaacatcaggacctagtggaagtactaccagcaaaactacttcagaatccagcagctctccctcagcatcccttaaaggcccaacttcacaagaatcacagctcaatgctatgaagcgattacagatggtcaagaagaaagctgcccaaaagaaactcaagaagtaa
Sequence Length
1389
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
48,808 Da
NCBI Official Full Name
Homo sapiens integrator complex subunit 12, mRNA
NCBI Official Synonym Full Names
integrator complex subunit 12
NCBI Official Symbol
INTS12
NCBI Official Synonym Symbols
INT12; PHF22; SBBI22
NCBI Protein Information
integrator complex subunit 12
UniProt Protein Name
Integrator complex subunit 12
Protein Family
UniProt Gene Name
INTS12
UniProt Synonym Gene Names
PHF22; Int12
UniProt Entry Name
INT12_HUMAN

NCBI Description

INTS12 is a subunit of the Integrator complex, which associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690) (Baillat et al., 2005 [PubMed 16239144]).[supplied by OMIM, Mar 2008]

Uniprot Description

PHF22: Component of the Integrator complex, a complex involved in the small nuclear RNAs (snRNA) U1 and U2 transcription and in their 3'-box-dependent processing. The Integrator complex is associated with the C-terminal domain (CTD) of RNA polymerase II largest subunit (POLR2A) and is recruited to the U1 and U2 snRNAs genes.

Protein type: RNA-binding

Chromosomal Location of Human Ortholog: 4q24

Cellular Component: integrator complex; nucleoplasm

Molecular Function: protein binding

Biological Process: snRNA processing; snRNA transcription from RNA polymerase II promoter

Research Articles on INTS12

Similar Products

Product Notes

The INTS12 ints12 (Catalog #AAA1274090) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctgcta ctgtgaactt ggaacttgat cccatttttt tgaaagcact aggtttcttg cattcaaaga gtaaagattc tgctgaaaag ctaaaagcac tgcttgatga atctttggct cggggcattg attccagtta ccgtccatct caaaaggatg tggagccacc caaaatttca agcacaaaaa acatttccat taagcaagag cccaaaatat catccagtct tccttctggt aataataatg gcaaggtcct cacaactgaa aaggtaaaga aggaagctga aaagagacct gctgataaaa tgaaatcaga catcactgaa ggagttgata ttccaaagaa acctagattg gagaaaccag aaacacagtc atctcccatt actgtccaaa gtagcaagga tttacctatg gctgaccttt ccagttttga ggagaccagt gctgatgatt ttgccatgga gatgggattg gcctgcgttg tttgtaggca aatgatggtg gcatctggca atcaattagt agaatgtcag gagtgccata atctctacca ccgagattgt cataaacccc aggtgacaga caaggaagcg aatgaccctc gcctggtgtg gtattgtgcc cgatgtacca gacaaatgaa aagaatggct caaaaaactc agaaaccacc gcagaaacca gcccctgcag ttgtttctgt aactccagct gtcaaagatc cattggttaa gaaaccagaa actaaactga aacaagagac aacttttcta gcgtttaaga gaacagaagt caagacatcc acagttattt caggaaattc ttctagtgcc agcgtttcct cgtcagtaac tagtggctta actggatggg cagcttttgc agccaaaact tcctctgctg gtccttcaac agcaaaattg agttcaacaa cacaaaacaa tactgggaaa cctgctactt cgtcagctaa ccagaaacct gtgggtttga ctggtctggc aacatcatcc aaaggtggaa taggttccaa aataggttcc aataacagca ctacgcccac tgtaccttta aaaccacctc cacctctaac cttgggtaaa actggcctta gtcgctcagt tagttgtgac aatgtcagca aagtaggtct tcctagtcca agtagtttag ttccaggaag cagcagccaa ctaagtggga atggaaatag tggaacatca ggacctagtg gaagtactac cagcaaaact acttcagaat ccagcagctc tccctcagca tcccttaaag gcccaacttc acaagaatca cagctcaatg ctatgaagcg attacagatg gtcaagaaga aagctgccca aaagaaactc aagaagtaa. It is sometimes possible for the material contained within the vial of "INTS12, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.