Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

INSIG2 cdna clone

INSIG2 cDNA Clone

Gene Names
INSIG2; INSIG-2
Synonyms
INSIG2; INSIG2 cDNA Clone; INSIG2 cdna clone
Ordering
For Research Use Only!
Sequence
atggcagaaggagagacagagtcacctgggcccaaaaagtgtggcccatatatttcatctgtcactagccagagtgtgaacttgatgattcgaggagtagtgctattttttattggagtatttcttgcattagtgttaaatttacttcagattcagagaaatgtgacgctctttccacctgatgtgattgcaagcatcttttcttctgcatggtgggtacccccatgctgtggcacggcttcagctgtgattgggttattatacccctgcattgacagacatctaggagaaccacataaatttaaaagagagtggtccagtgtaatgcggtgtgtagcagtctttgttggtataaatcatgccagtgctaaagtggatttcgataacaacatacagttgtctctcacactggctgcactatccattggactgtggtggacttttgatagatctagaagtggttttggccttggagtaggaattgccttcttggcaactgtggtcactcaactgctagtatataatggtgtttaccaatatacatctccagatttcctctatgttcgttcttggttaccatgtatattttttgctggaggcataacaatgggaaacattggtcgacaactggcaatgtacgaatgtaaagttatcgcagaaaaatctcatcaggaatga
Sequence Length
678
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
24,778 Da
NCBI Official Full Name
Homo sapiens insulin induced gene 2, mRNA
NCBI Official Synonym Full Names
insulin induced gene 2
NCBI Official Symbol
INSIG2
NCBI Official Synonym Symbols
INSIG-2
NCBI Protein Information
insulin-induced gene 2 protein
UniProt Protein Name
Insulin-induced gene 2 protein
UniProt Gene Name
INSIG2
UniProt Synonym Gene Names
INSIG-2
UniProt Entry Name
INSI2_HUMAN

NCBI Description

The protein encoded by this gene is highly similar to the protein product encoded by gene INSIG1. Both INSIG1 protein and this protein are endoplasmic reticulum proteins that block the processing of sterol regulatory element binding proteins (SREBPs) by binding to SREBP cleavage-activating protein (SCAP), and thus prevent SCAP from escorting SREBPs to the Golgi. [provided by RefSeq, Jul 2008]

Uniprot Description

INSIG2: Mediates feedback control of cholesterol synthesis by controlling SCAP and HMGCR. Functions by blocking the processing of sterol regulatory element-binding proteins (SREBPs). Capable of retaining the SCAP-SREBF2 complex in the ER thus preventing it from escorting SREBPs to the Golgi. Seems to regulate the ubiquitin-mediated proteasomal degradation of HMGCR. Belongs to the INSIG family.

Protein type: Membrane protein, integral; Endoplasmic reticulum; Transcription, coactivator/corepressor; Membrane protein, multi-pass

Chromosomal Location of Human Ortholog: 2q14.2

Cellular Component: endoplasmic reticulum membrane

Molecular Function: protein binding

Biological Process: SREBP-mediated signaling pathway

Research Articles on INSIG2

Similar Products

Product Notes

The INSIG2 insig2 (Catalog #AAA1266919) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcagaag gagagacaga gtcacctggg cccaaaaagt gtggcccata tatttcatct gtcactagcc agagtgtgaa cttgatgatt cgaggagtag tgctattttt tattggagta tttcttgcat tagtgttaaa tttacttcag attcagagaa atgtgacgct ctttccacct gatgtgattg caagcatctt ttcttctgca tggtgggtac ccccatgctg tggcacggct tcagctgtga ttgggttatt atacccctgc attgacagac atctaggaga accacataaa tttaaaagag agtggtccag tgtaatgcgg tgtgtagcag tctttgttgg tataaatcat gccagtgcta aagtggattt cgataacaac atacagttgt ctctcacact ggctgcacta tccattggac tgtggtggac ttttgataga tctagaagtg gttttggcct tggagtagga attgccttct tggcaactgt ggtcactcaa ctgctagtat ataatggtgt ttaccaatat acatctccag atttcctcta tgttcgttct tggttaccat gtatattttt tgctggaggc ataacaatgg gaaacattgg tcgacaactg gcaatgtacg aatgtaaagt tatcgcagaa aaatctcatc aggaatga. It is sometimes possible for the material contained within the vial of "INSIG2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.