Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

INHA cdna clone

INHA cDNA Clone

Synonyms
INHA; INHA cDNA Clone; INHA cdna clone
Ordering
For Research Use Only!
Sequence
atggtgctgcacctactgctcttcttgctgctgaccccacagggtgggcacagctgccaggggctggagctggcccgggaacttgttctggccaaggtgagggccctgttcttggatgccttggggccccccgcggtgaccagggaaggtggggaccctggagtcaggcggctgccccgaagacatgccctggggggcttcacacacaggggctctgagcccgaggaagaggaggatgtctcccaagccatccttttcccagccacagatgccagctgtgaggacaagtcagctgccagagggctggcccaggaggctgaggagggcctcttcagatacatgttccggccatcccagcatacacgcagccgccaggtgacttcagcccagctgtggttccacaccgggctggacaggcagggcacagcagcctccaatagctctgagcccctgctaggcctgctggcactgtcaccgggaggacccgtggctgtgcccatgtctttgggccatgctccccctcactgggccgtgctgcacctggccacctctgctctctctctgctgacccaccccgtcctggtgctgctgctgcgctgtcccctctgtacctgctcagcccggcctgaggccacgcccttcctggtggcccacactcggaccagaccacccagtggaggggagagagcccgacgctcaactcccctgatgtcctggccttggtctccctctgctctgcgcctgctgcagaggcctccggaggaaccggctgcccatgccaactgccacagagtagcactgaacatctccttccaggagctgggctgggaacggtggatcgtgtaccctcccagtttcatcttccactactgtcatggtggttgtgggctgcacatcccaccaaacctgtcccttccagtccctggggctccccctaccccagcccagccctactccttgctgccaggggcccagccctgctgtgctgctctcccagggaccatgaggcccctacatgtccgcaccacctcggatggaggttactctttcaagtatgagacagtgcccaaccttctcacgcagcactgtgcttgtatctaa
Sequence Length
1101
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
39,670 Da
NCBI Official Full Name
Homo sapiens inhibin, alpha, mRNA
NCBI Official Synonym Full Names
inhibin alpha subunit
NCBI Official Symbol
INHA
NCBI Protein Information
inhibin alpha chain
UniProt Protein Name
Inhibin alpha chain
Protein Family
UniProt Gene Name
INHA
UniProt Entry Name
INHA_HUMAN

NCBI Description

This gene encodes a member of the TGF-beta (transforming growth factor-beta) superfamily of proteins. The encoded preproprotein is proteolytically processed to generate multiple peptide products, including the alpha subunit of the inhibin A and B protein complexes. These complexes negatively regulate follicle stimulating hormone secretion from the pituitary gland. Inhibins have also been implicated in regulating numerous cellular processes including cell proliferation, apoptosis, immune response and hormone secretion. Mutations in this gene may be associated with male infertility and premature ovarian failure in female human patients. [provided by RefSeq, Aug 2016]

Uniprot Description

INHA: Inhibins and activins inhibit and activate, respectively, the secretion of follitropin by the pituitary gland. Inhibins/activins are involved in regulating a number of diverse functions such as hypothalamic and pituitary hormone secretion, gonadal hormone secretion, germ cell development and maturation, erythroid differentiation, insulin secretion, nerve cell survival, embryonic axial development or bone growth, depending on their subunit composition. Inhibins appear to oppose the functions of activins. Belongs to the TGF-beta family.

Protein type: Secreted; Secreted, signal peptide

Chromosomal Location of Human Ortholog: 2q35

Cellular Component: extracellular region

Molecular Function: cytokine activity; growth factor activity; hormone activity; protein binding; receptor binding; transforming growth factor beta receptor binding

Biological Process: cell cycle arrest; cell development; cell differentiation; cell surface receptor linked signal transduction; cell-cell signaling; hemoglobin biosynthetic process; negative regulation of B cell differentiation; negative regulation of cell cycle; negative regulation of interferon-gamma biosynthetic process; negative regulation of macrophage differentiation; negative regulation of phosphorylation; positive regulation of follicle-stimulating hormone secretion; regulation of apoptosis; regulation of cell cycle; regulation of cell proliferation; regulation of MAPKKK cascade; response to external stimulus; signal transduction; skeletal development

Research Articles on INHA

Similar Products

Product Notes

The INHA inha (Catalog #AAA1276355) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggtgctgc acctactgct cttcttgctg ctgaccccac agggtgggca cagctgccag gggctggagc tggcccggga acttgttctg gccaaggtga gggccctgtt cttggatgcc ttggggcccc ccgcggtgac cagggaaggt ggggaccctg gagtcaggcg gctgccccga agacatgccc tggggggctt cacacacagg ggctctgagc ccgaggaaga ggaggatgtc tcccaagcca tccttttccc agccacagat gccagctgtg aggacaagtc agctgccaga gggctggccc aggaggctga ggagggcctc ttcagataca tgttccggcc atcccagcat acacgcagcc gccaggtgac ttcagcccag ctgtggttcc acaccgggct ggacaggcag ggcacagcag cctccaatag ctctgagccc ctgctaggcc tgctggcact gtcaccggga ggacccgtgg ctgtgcccat gtctttgggc catgctcccc ctcactgggc cgtgctgcac ctggccacct ctgctctctc tctgctgacc caccccgtcc tggtgctgct gctgcgctgt cccctctgta cctgctcagc ccggcctgag gccacgccct tcctggtggc ccacactcgg accagaccac ccagtggagg ggagagagcc cgacgctcaa ctcccctgat gtcctggcct tggtctccct ctgctctgcg cctgctgcag aggcctccgg aggaaccggc tgcccatgcc aactgccaca gagtagcact gaacatctcc ttccaggagc tgggctggga acggtggatc gtgtaccctc ccagtttcat cttccactac tgtcatggtg gttgtgggct gcacatccca ccaaacctgt cccttccagt ccctggggct ccccctaccc cagcccagcc ctactccttg ctgccagggg cccagccctg ctgtgctgct ctcccaggga ccatgaggcc cctacatgtc cgcaccacct cggatggagg ttactctttc aagtatgaga cagtgcccaa ccttctcacg cagcactgtg cttgtatcta a. It is sometimes possible for the material contained within the vial of "INHA, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.