Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

IMPDH2 cdna clone

IMPDH2 cDNA Clone

Gene Names
IMPDH2; IMPD2; IMPDH-II
Synonyms
IMPDH2; IMPDH2 cDNA Clone; IMPDH2 cdna clone
Ordering
For Research Use Only!
Sequence
atggccgactacctgattagtgggggcacgtcctacgtgccagacgacggactcacagcacagcagctcttcaactgcggagacggcctcacctacaatgactttctcattctccctgggtacatcgacttcactgcagaccaggtggacctgacttctgctctgaccaagaaaatcactcttaagaccccactggtttcctctcccatggacacagtcacagaggctgggatggccatagcaatggcgcttacaggcggtattggcttcatccaccacaactgtacacctgaattccaggccaatgaagttcggaaagtgaagaaatatgaacagggattcatcacagaccctgtggtcctcagccccaaggatcgcgtgcgggatgtttttgaggccaaggcccggcatggtttctgcggtatcccaatcacagacacaggccggatggggagccgcttggtgggcatcatctcctccagggacattgattttctcaaagaggaggaacatgactgtttcttggaagagataatgacaaagagggaagacttggtggtagcccctgcaggcatcacactgaaggaggcaaatgaaattctgcagcgcagcaagaagggaaagttgcccattgtaaatgaagatgatgagcttgtggccatcattgcccggacagacctgaagaagaatcgggactacccactagcctccaaagatgccaagaaacagctgctgtgtggggcagccattggcactcatgaggatgacaagtataggctggacttgctcgcccaggctggtgtggatgtagtggttttggactcttcccagggaaattccatcttccagatcaatatgatcaagtacatcaaagacaaataccctaatctccaagtcattggaggcaatgtggtcactgctgcccaggccaagaacctcattgatgcaggtgtggatgccctgcgggtgggcatgggaagtggctccatctgcattacgcaggaagtgctggcctgtgggcggccccaagcaacagcagtgtacaaggtgtcagagtatgcacggcgctttggtgttccggtcattgctgatggaggaatccaaaatgtgggtcatattgcgaaagccttggcccttggggcctccacagtcatgatgggctctctcctggctgccaccactgaggcccctggtgaatacttcttttccgatgggatccggctaaagaaatatcgcggtatgggttctctcgatgccatggacaagcacctcagcagccagaacagatatttcagtgaagctgacaaaatcaaagtggcccagggagtgtctggtgctgtgcaggacaaagggtcaatccacaaatttgtcccttacctgattgctggcatccaacactcatgccaggacattggtgccaagagcttgacccaagtccgagccatgatgtactctggggagcttaagtttgagaagagaacgtcctcagcccaggtggaaggtggcgtccatagcctccattcgtatgagaagcggcttttctga
Sequence Length
1545
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
55,805 Da
NCBI Official Full Name
Homo sapiens IMP (inosine monophosphate) dehydrogenase 2, mRNA
NCBI Official Synonym Full Names
inosine monophosphate dehydrogenase 2
NCBI Official Symbol
IMPDH2
NCBI Official Synonym Symbols
IMPD2; IMPDH-II
NCBI Protein Information
inosine-5'-monophosphate dehydrogenase 2
UniProt Protein Name
Inosine-5'-monophosphate dehydrogenase 2
UniProt Gene Name
IMPDH2
UniProt Synonym Gene Names
IMP dehydrogenase 2; IMPD 2; IMPDH 2
UniProt Entry Name
IMDH2_HUMAN

NCBI Description

This gene encodes the rate-limiting enzyme in the de novo guanine nucleotide biosynthesis. It is thus involved in maintaining cellular guanine deoxy- and ribonucleotide pools needed for DNA and RNA synthesis. The encoded protein catalyzes the NAD-dependent oxidation of inosine-5'-monophosphate into xanthine-5'-monophosphate, which is then converted into guanosine-5'-monophosphate. This gene is up-regulated in some neoplasms, suggesting it may play a role in malignant transformation. [provided by RefSeq, Jul 2008]

Uniprot Description

IMPDH2: a rate limiting enzyme in the de novo synthesis of guanine nucleotides and therefore is involved in the regulation of cell growth. It may also have a role in the development of malignancy and the growth progression of some tumors.

Protein type: EC 1.1.1.205; Nucleotide Metabolism - purine; Oxidoreductase; Xenobiotic Metabolism - drug metabolism - other enzymes

Chromosomal Location of Human Ortholog: 3p21.2

Cellular Component: cytoplasm; cytosol; membrane; nucleus; peroxisomal membrane

Molecular Function: IMP dehydrogenase activity; nucleotide binding; protein binding

Biological Process: GTP biosynthetic process; purine ribonucleoside monophosphate biosynthetic process

Research Articles on IMPDH2

Similar Products

Product Notes

The IMPDH2 impdh2 (Catalog #AAA1273729) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccgact acctgattag tgggggcacg tcctacgtgc cagacgacgg actcacagca cagcagctct tcaactgcgg agacggcctc acctacaatg actttctcat tctccctggg tacatcgact tcactgcaga ccaggtggac ctgacttctg ctctgaccaa gaaaatcact cttaagaccc cactggtttc ctctcccatg gacacagtca cagaggctgg gatggccata gcaatggcgc ttacaggcgg tattggcttc atccaccaca actgtacacc tgaattccag gccaatgaag ttcggaaagt gaagaaatat gaacagggat tcatcacaga ccctgtggtc ctcagcccca aggatcgcgt gcgggatgtt tttgaggcca aggcccggca tggtttctgc ggtatcccaa tcacagacac aggccggatg gggagccgct tggtgggcat catctcctcc agggacattg attttctcaa agaggaggaa catgactgtt tcttggaaga gataatgaca aagagggaag acttggtggt agcccctgca ggcatcacac tgaaggaggc aaatgaaatt ctgcagcgca gcaagaaggg aaagttgccc attgtaaatg aagatgatga gcttgtggcc atcattgccc ggacagacct gaagaagaat cgggactacc cactagcctc caaagatgcc aagaaacagc tgctgtgtgg ggcagccatt ggcactcatg aggatgacaa gtataggctg gacttgctcg cccaggctgg tgtggatgta gtggttttgg actcttccca gggaaattcc atcttccaga tcaatatgat caagtacatc aaagacaaat accctaatct ccaagtcatt ggaggcaatg tggtcactgc tgcccaggcc aagaacctca ttgatgcagg tgtggatgcc ctgcgggtgg gcatgggaag tggctccatc tgcattacgc aggaagtgct ggcctgtggg cggccccaag caacagcagt gtacaaggtg tcagagtatg cacggcgctt tggtgttccg gtcattgctg atggaggaat ccaaaatgtg ggtcatattg cgaaagcctt ggcccttggg gcctccacag tcatgatggg ctctctcctg gctgccacca ctgaggcccc tggtgaatac ttcttttccg atgggatccg gctaaagaaa tatcgcggta tgggttctct cgatgccatg gacaagcacc tcagcagcca gaacagatat ttcagtgaag ctgacaaaat caaagtggcc cagggagtgt ctggtgctgt gcaggacaaa gggtcaatcc acaaatttgt cccttacctg attgctggca tccaacactc atgccaggac attggtgcca agagcttgac ccaagtccga gccatgatgt actctgggga gcttaagttt gagaagagaa cgtcctcagc ccaggtggaa ggtggcgtcc atagcctcca ttcgtatgag aagcggcttt tctga. It is sometimes possible for the material contained within the vial of "IMPDH2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.