Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ILKAP cdna clone

ILKAP cDNA Clone

Gene Names
ILKAP; PPM1O; ILKAP2; ILKAP3; PP2C-DELTA
Synonyms
ILKAP; ILKAP cDNA Clone; ILKAP cdna clone
Ordering
For Research Use Only!
Sequence
atggacctcttcggggacctgccggagcccgagcgctcgccgcgcccggctgccgggaaagaagctcagaaaggacccctgctctttgatgacctccctccggccagcagtactgactcaggatcagggggacctttgctttttgatgatctcccacccgctagcagtggcgattcaggttctcttgccacatcaatatcccagatggtaaagactgaagggaaaggagcaaagagaaaaacctccgaggaagagaagaatggcagtgaagagcttgtggaaaagaaagtttgtaaagcctcttcggtgatctttggtctgaagggctatgtggctgagcggaagggtgagagggaggagatgcaggatgcccacgtcatcctgaacgacatcaccgaggagtgtaggcccccatcgtccctcattactcgggtttcatattttgctgtttttgatggacatggaggaattcgagcctcaaaatttgctgcacagaatttgcatcaaaacttaatcagaaaatttcctaaaggagatgtaatcagtgtagagaaaaccgtgaagagatgccttttggacactttcaagcatactgatgaagagttccttaaacaagcttccagccagaagcctgcctggaaagatgggtccactgccacgtgtgttctggctgtagacaacattctttatattgccaacctcggagatagtcgggcaatcttgtgtcgttataatgaggagagtcaaaaacatgcagccttaagcctcagcaaagagcataatccaactcagtatgaagagcggatgaggatacagaaggctggaggaaacgtcagggatgggcgtgttttgggcgtgctagaggtgtcacgctccattggggacgggcagtacaagcgctgcggtgtcacctctgtgcccgacatcagacgctgccagctgacccccaatgacaggttcattttgttggcctgtgatgggctcttcaaggtctttaccccagaagaagccgtgaacttcatcttgtcctgtctcgaggatgaaaagatccagacccgggaagggaagtccgcagccgacgcccgctacgaagcagcctgcaacaggctggccaacaaggcggtgcagcggggctcggccgacaacgtcactgtgatggtggtgcggatagggcactga
Sequence Length
1179
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
42,907 Da
NCBI Official Full Name
Homo sapiens integrin-linked kinase-associated serine/threonine phosphatase 2C, mRNA
NCBI Official Synonym Full Names
ILK associated serine/threonine phosphatase
NCBI Official Symbol
ILKAP
NCBI Official Synonym Symbols
PPM1O; ILKAP2; ILKAP3; PP2C-DELTA
NCBI Protein Information
integrin-linked kinase-associated serine/threonine phosphatase 2C
UniProt Protein Name
Integrin-linked kinase-associated serine/threonine phosphatase 2C
UniProt Gene Name
ILKAP
UniProt Synonym Gene Names
ILKAP
UniProt Entry Name
ILKAP_HUMAN

NCBI Description

The protein encoded by this gene is a protein serine/threonine phosphatase of the PP2C family. This protein can interact with integrin-linked kinase (ILK/ILK1), a regulator of integrin mediated signaling, and regulate the kinase activity of ILK. Through the interaction with ILK, this protein may selectively affect the signaling process of ILK-mediated glycogen synthase kinase 3 beta (GSK3beta), and thus participate in Wnt signaling pathway. [provided by RefSeq, Jul 2008]

Uniprot Description

ILKAP: a protein serine/threonine phosphatase of the PP2C family. Can interact with integrin-linked kinase (ILK/ILK1), a regulator of integrin mediated signaling, and regulate the kinase activity of ILK. Through the interaction with ILK, this protein may selectively affect the signaling process of ILK-mediated glycogen synthase kinase 3 beta (GSK3beta), and thus participate in Wnt signaling pathway. Alternatively spliced transcript variants encoding distinct isoforms have been described.

Protein type: EC 3.1.3.16; Protein phosphatase, Ser/Thr (non-receptor); Motility/polarity/chemotaxis

Chromosomal Location of Human Ortholog: 2q37.3

Molecular Function: protein binding

Research Articles on ILKAP

Similar Products

Product Notes

The ILKAP ilkap (Catalog #AAA1268212) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggacctct tcggggacct gccggagccc gagcgctcgc cgcgcccggc tgccgggaaa gaagctcaga aaggacccct gctctttgat gacctccctc cggccagcag tactgactca ggatcagggg gacctttgct ttttgatgat ctcccacccg ctagcagtgg cgattcaggt tctcttgcca catcaatatc ccagatggta aagactgaag ggaaaggagc aaagagaaaa acctccgagg aagagaagaa tggcagtgaa gagcttgtgg aaaagaaagt ttgtaaagcc tcttcggtga tctttggtct gaagggctat gtggctgagc ggaagggtga gagggaggag atgcaggatg cccacgtcat cctgaacgac atcaccgagg agtgtaggcc cccatcgtcc ctcattactc gggtttcata ttttgctgtt tttgatggac atggaggaat tcgagcctca aaatttgctg cacagaattt gcatcaaaac ttaatcagaa aatttcctaa aggagatgta atcagtgtag agaaaaccgt gaagagatgc cttttggaca ctttcaagca tactgatgaa gagttcctta aacaagcttc cagccagaag cctgcctgga aagatgggtc cactgccacg tgtgttctgg ctgtagacaa cattctttat attgccaacc tcggagatag tcgggcaatc ttgtgtcgtt ataatgagga gagtcaaaaa catgcagcct taagcctcag caaagagcat aatccaactc agtatgaaga gcggatgagg atacagaagg ctggaggaaa cgtcagggat gggcgtgttt tgggcgtgct agaggtgtca cgctccattg gggacgggca gtacaagcgc tgcggtgtca cctctgtgcc cgacatcaga cgctgccagc tgacccccaa tgacaggttc attttgttgg cctgtgatgg gctcttcaag gtctttaccc cagaagaagc cgtgaacttc atcttgtcct gtctcgagga tgaaaagatc cagacccggg aagggaagtc cgcagccgac gcccgctacg aagcagcctg caacaggctg gccaacaagg cggtgcagcg gggctcggcc gacaacgtca ctgtgatggt ggtgcggata gggcactga. It is sometimes possible for the material contained within the vial of "ILKAP, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.