Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ILF3 cdna clone

ILF3 cDNA Clone

Gene Names
ILF3; CBTF; DRBF; MMP4; MPP4; NF90; NFAR; NF110; NF90a; NF90b; NFAR2; TCP80; DRBP76; NF110b; NFAR-1; TCP110; MPHOSPH4; NF-AT-90
Synonyms
ILF3; ILF3 cDNA Clone; ILF3 cdna clone
Ordering
For Research Use Only!
Sequence
atgtgttcatgtcctatctcctctcctggacacattaaggggttgggacaagaagagactcctgtgagatcagcagacctcgtgtttaaggagagaatgcctgcctgcaacactcatggagagggacacttcctggccccacctgctaaatacctccaaactctgggcaggcgcctgcattctcaacacaggacttcccttaacagtttccggatcagtgaccaccaccacgttcaggtttctgaatgcagacccaccacgagggatggattccacccgcccgccctgctgcagatacatgcggcacagcaggcacgtgcctggagagaacagctcctgagcacagcacccttggagccctcaccccgctcacgatcctcaccagtgctgatgatgccgtcatgctgctggcctgagacagtatcccagctacaacaggacgacaccgggttcaggaatatgtggctatcaccttga
Sequence Length
477
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
95,808 Da
NCBI Official Full Name
Homo sapiens interleukin enhancer binding factor 3, 90kDa, mRNA
NCBI Official Synonym Full Names
interleukin enhancer binding factor 3
NCBI Official Symbol
ILF3
NCBI Official Synonym Symbols
CBTF; DRBF; MMP4; MPP4; NF90; NFAR; NF110; NF90a; NF90b; NFAR2; TCP80; DRBP76; NF110b; NFAR-1; TCP110; MPHOSPH4; NF-AT-90
NCBI Protein Information
interleukin enhancer-binding factor 3
UniProt Protein Name
Interleukin enhancer-binding factor 3
UniProt Gene Name
ILF3
UniProt Synonym Gene Names
DRBF; MPHOSPH4; NF90; DRBP76; MPP4; NFAR; NF-AT-90; TCP80
UniProt Entry Name
ILF3_HUMAN

NCBI Description

This gene encodes a double-stranded RNA (dsRNA) binding protein that complexes with other proteins, dsRNAs, small noncoding RNAs, and mRNAs to regulate gene expression and stabilize mRNAs. This protein (NF90, ILF3) forms a heterodimer with a 45 kDa transcription factor (NF45, ILF2) required for T-cell expression of interleukin 2. This complex has been shown to affect the redistribution of nuclear mRNA to the cytoplasm. Knockdown of NF45 or NF90 protein retards cell growth, possibly by inhibition of mRNA stabilization. In contrast, an isoform (NF110) of this gene that is predominantly restricted to the nucleus has only minor effects on cell growth when its levels are reduced. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Dec 2014]

Uniprot Description

NFAT90: a double-stranded RNA (dsRNA)-binding protein implicated in the regulation of gene expression . Phosphorylated in a double-stranded RNA-dependent manner possibly by PKR. Five different splice-variant isoforms have been described.

Protein type: Transcription factor; DNA-binding; Nucleolus; RNA-binding

Chromosomal Location of Human Ortholog: 19p13.2

Cellular Component: cytoplasm; membrane; mitochondrion; nucleolus; nucleoplasm; nucleus; ribonucleoprotein complex

Molecular Function: DNA binding; double-stranded RNA binding; protein binding

Biological Process: negative regulation of transcription, DNA-dependent; negative regulation of translation; negative regulation of viral genome replication; positive regulation of transcription, DNA-dependent; protein amino acid phosphorylation

Research Articles on ILF3

Similar Products

Product Notes

The ILF3 ilf3 (Catalog #AAA1274920) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtgttcat gtcctatctc ctctcctgga cacattaagg ggttgggaca agaagagact cctgtgagat cagcagacct cgtgtttaag gagagaatgc ctgcctgcaa cactcatgga gagggacact tcctggcccc acctgctaaa tacctccaaa ctctgggcag gcgcctgcat tctcaacaca ggacttccct taacagtttc cggatcagtg accaccacca cgttcaggtt tctgaatgca gacccaccac gagggatgga ttccacccgc ccgccctgct gcagatacat gcggcacagc aggcacgtgc ctggagagaa cagctcctga gcacagcacc cttggagccc tcaccccgct cacgatcctc accagtgctg atgatgccgt catgctgctg gcctgagaca gtatcccagc tacaacagga cgacaccggg ttcaggaata tgtggctatc accttga. It is sometimes possible for the material contained within the vial of "ILF3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.