Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

IL7 cdna clone

IL7 cDNA Clone

Gene Names
IL7; IL-7
Synonyms
IL7; IL7 cDNA Clone; IL7 cdna clone
Ordering
For Research Use Only!
Sequence
atgttccatgtttcttttaggtatatctttggacttcctcccctgatccttgttctgttgccagtagcatcatctgattgtgatattgaaggtaaagatggcaaacaatatgagagtgttctaatggtcagcatcgatcaattattggacagcatgaaagaaattggtagcaattgcctgaataatgaatttaacttttttaaaagacatatctgtgatgctaataaggaaggtatgtttttattccgtgctgctcgcaagttgaggcaatttcttaaaatgaatagcactggtgattttgatctccacttattaaaagtttcagaaggcacaacaatactgttgaactgcactggccaggttaaaggaagaaaaccagctgccctgggtgaagcccaaccaacaaagagtttggaagaaaataaatctttaaaggaacagaaaaaactgaatgacttgtgtttcctaaagagactattacaagagataaaaacttgttggaataaaattttgatgggcactaaagaacactga
Sequence Length
534
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
7,687 Da
NCBI Official Full Name
Homo sapiens interleukin 7, mRNA
NCBI Official Synonym Full Names
interleukin 7
NCBI Official Symbol
IL7
NCBI Official Synonym Symbols
IL-7
NCBI Protein Information
interleukin-7
UniProt Protein Name
Interleukin-7
Protein Family
UniProt Gene Name
IL7
UniProt Synonym Gene Names
IL-7
UniProt Entry Name
IL7_HUMAN

NCBI Description

The protein encoded by this gene is a cytokine important for B and T cell development. This cytokine and the hepatocyte growth factor (HGF) form a heterodimer that functions as a pre-pro-B cell growth-stimulating factor. This cytokine is found to be a cofactor for V(D)J rearrangement of the T cell receptor beta (TCRB) during early T cell development. This cytokine can be produced locally by intestinal epithelial and epithelial goblet cells, and may serve as a regulatory factor for intestinal mucosal lymphocytes. Knockout studies in mice suggested that this cytokine plays an essential role in lymphoid cell survival. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Additional splice variants have been described but their presence in normal tissues has not been confirmed.[provided by RefSeq, Dec 2010]

Uniprot Description

IL7: Hematopoietic growth factor capable of stimulating the proliferation of lymphoid progenitors. It is important for proliferation during certain stages of B-cell maturation. Belongs to the IL-7/IL-9 family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Cell development/differentiation; Secreted, signal peptide; Apoptosis; Secreted; Cell cycle regulation; Cytokine

Chromosomal Location of Human Ortholog: 8q12-q13

Cellular Component: extracellular region; extracellular space

Molecular Function: cytokine activity; growth factor activity; protein binding

Biological Process: bone resorption; cell-cell signaling; humoral immune response; negative regulation of apoptosis; organ morphogenesis; positive regulation of B cell proliferation; positive regulation of cell proliferation; positive regulation of T cell differentiation; T cell lineage commitment

Research Articles on IL7

Similar Products

Product Notes

The IL7 il7 (Catalog #AAA1272044) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgttccatg tttcttttag gtatatcttt ggacttcctc ccctgatcct tgttctgttg ccagtagcat catctgattg tgatattgaa ggtaaagatg gcaaacaata tgagagtgtt ctaatggtca gcatcgatca attattggac agcatgaaag aaattggtag caattgcctg aataatgaat ttaacttttt taaaagacat atctgtgatg ctaataagga aggtatgttt ttattccgtg ctgctcgcaa gttgaggcaa tttcttaaaa tgaatagcac tggtgatttt gatctccact tattaaaagt ttcagaaggc acaacaatac tgttgaactg cactggccag gttaaaggaa gaaaaccagc tgccctgggt gaagcccaac caacaaagag tttggaagaa aataaatctt taaaggaaca gaaaaaactg aatgacttgt gtttcctaaa gagactatta caagagataa aaacttgttg gaataaaatt ttgatgggca ctaaagaaca ctga. It is sometimes possible for the material contained within the vial of "IL7, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.