Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

IL6ST cdna clone

IL6ST cDNA Clone

Gene Names
IL6ST; CD130; GP130; CDW130; IL-6RB
Synonyms
IL6ST; IL6ST cDNA Clone; IL6ST cdna clone
Ordering
For Research Use Only!
Sequence
atgttgacgttgcagacttggctagtgcaagccttgtttattttcctcaccactgaatctacaggtgaacttctagatccatgtggttatatcagtcctgaatctccagttgtacaacttcattctaatttcactgcagtttgtgtgctaaaggaaaaatgtatggattattttcatgtaaatgctaattacattgtctggaaaacaaaccattttactattcctaaggagcaatatactatcataaacagaacagcatccagtgtcacctttacagatatagcttcattaaatattcagctcacttgcaacattcttacattcggacagcttgaacagaatgtttatggaatcacaataatttcaggcttgcctccagaaaaacctaaaaatttgagttgcattgtgaacgaggggaagaaaatgaggtgtgagtgggatcgtggaagggaaacacacttggagacaaacttcactttaaaatctgaatgggcaacacacaagtttgctgattgcaaagcaaaacgtgacacccccacctcatgcactgttgattattctactgtgtattttgtcaacattgaagtctgggtagaagcagagaatgcccttgggaaggttacatcagatcatatcaattttgatcctgtatataaagtgaagcccaatccgccacataatttatcagtgatcaactcagaggaactgtctagtatcttaaaattgacatggaccaacccaagtattaagagtgttataatactaaaatataacattcaatataggaccaaagatgcctcaacttggagccagattcctcctgaagacacagcatccacccgatcttcattcactgtccaagaccttaaaccttttacagaatatgtgtttaggattcgctgtatgaaggaagatggtaagggatactggagtgactggagtgaagaagcaagtgggatcacctatgaagatagaccatctaaagcaccaagtttctggtataaaatagatccatcccatactcaaggctacagaactgtacaactcgtgtggaagacattgcctccttttgaagccaatggaaaaatcttggattatgaagtgactctcacaagatggaaatcacatttacaaaattacacagttaatgccacaaaactgacagtaaatctcacaaatgatcgctatgtagcaaccctaacagtaagaaatcttgttggcaaatcagatgcagctgttttaactatccctgcctgtgactttcaagctactcaccctgtaatggatcttaaagcattccccaaagataacatgctttgggtggaatggactactccaagggaatctgtaaagaaatatatacttgagtggtgtgtgttatcagataaagcaccctgtatcacagactggcaacaagaagatggtaccgtgcatcgcacctatttaagagggaacttagcagagagcaaatgctatttgataacagttactccagtatatgctgatggaccaggaagccctgaatccataaaggcataccttaaacaagctccaccttccaaaggacctactgttcggacaaaaaaagtagggaaaaacgaagctgtcttagagtgggaccaacttcctgttgatgttcagaatggatttatcagaaattatactatattttatagaaccatcattggaaatgaaactgctgtgaatgtggattcttcccacacagaatatacattgtcctctttgactagtgacacattgtacatggtacgaatggcagcatacacagatgaaggtgggaaggatggtccagaattcacttttactaccccaaagtttgctcaaggagaaattgaagccatagtcgtgcctgtttgcttagcattcctattgacaactcttctgggagtgctgttctgctttaataagcgagacctaattaaaaaacacatctggcctaatgttccagatccttcaaagagtcatattgcccagtggtcacctcacactcctccaaggcacaattttaattcaaaagatcaaatgtattcagatggcaatttcactgatgtaagtgttgtggaaatagaagcaaatgacaaaaagccttttccagaagatctgaaatcattggacctgttcaaaaaggaaaaaattaatactgaaggacacagcagtggtattggggggtcttcatgcatgtcatcttctaggccaagcatttctagcagtgatgaaaatgaatcttcacaaaacacttcgagcactgtccagtattctaccgtggtacacagtggctacagacaccaagttccgtcagtccaagtcttctcaagatccgagtctacccagcccttgttagattcagaggagcggccagaagatctacaattagtagatcatgtagatggcggtgatggtattttgcccaggcaacagtacttcaaacagaactgcagtcagcatgaatccagtccagatatttcacattttgaaaggtcaaagcaagtttcatcagtcaatgaggaagattttgttagacttaaacagcagatttcagatcatatttcacaatcctgtggatctgggcaaatgaaaatgtttcaggaagtttctgcagcagatgcttttggtccaggtactgagggacaagtagaaagatttgaaacagttggcatggaggctgcgactgatgaaggcatgcctaaaagttacttaccacagactgtacggcaaggcggctacatgcctcagtga
Sequence Length
2757
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
96,276 Da
NCBI Official Full Name
Homo sapiens interleukin 6 signal transducer (gp130, oncostatin M receptor), mRNA
NCBI Official Synonym Full Names
interleukin 6 signal transducer
NCBI Official Symbol
IL6ST
NCBI Official Synonym Symbols
CD130; GP130; CDW130; IL-6RB
NCBI Protein Information
interleukin-6 receptor subunit beta
UniProt Protein Name
Interleukin-6 receptor subunit beta
Protein Family
UniProt Gene Name
IL6ST
UniProt Synonym Gene Names
IL-6 receptor subunit beta; IL-6R subunit beta; IL-6R-beta; IL-6RB; gp130
UniProt Entry Name
IL6RB_HUMAN

NCBI Description

The protein encoded by this gene is a signal transducer shared by many cytokines, including interleukin 6 (IL6), ciliary neurotrophic factor (CNTF), leukemia inhibitory factor (LIF), and oncostatin M (OSM). This protein functions as a part of the cytokine receptor complex. The activation of this protein is dependent upon the binding of cytokines to their receptors. vIL6, a protein related to IL6 and encoded by the Kaposi sarcoma-associated herpesvirus, can bypass the interleukin 6 receptor (IL6R) and directly activate this protein. Knockout studies in mice suggest that this gene plays a critical role in regulating myocyte apoptosis. Alternatively spliced transcript variants have been described. A related pseudogene has been identified on chromosome 17. [provided by RefSeq, May 2014]

Uniprot Description

gp130: gp130 is a ubiquitously expressed type I cytokine family receptor. The receptor systems for IL6, LIF, OSM, CNTF, IL11 AND CT1 utilize gp130 for initiating signal transmission. Binds to IL6/IL6R (alpha chain) complex, resulting in the formation of high-affinity IL6 binding sites, and transduces the signal. Does not directly bind IL6. May have a role in embryonic development. Contains 5 fibronectin type III domains and 1 immunoglobulin-like C2-type domain. Two alternatively spliced isoforms have been described.

Protein type: Membrane protein, integral; Receptor, cytokine

Chromosomal Location of Human Ortholog: 5q11.2

Cellular Component: extracellular region; interleukin-6 receptor complex; membrane; oncostatin-M receptor complex; plasma membrane

Molecular Function: ciliary neurotrophic factor receptor activity; ciliary neurotrophic factor receptor binding; growth factor binding; interleukin-27 receptor activity; interleukin-6 binding; interleukin-6 receptor activity; interleukin-6 receptor binding; leukemia inhibitory factor receptor activity; oncostatin-M receptor activity; protein binding; protein homodimerization activity

Biological Process: cytokine and chemokine mediated signaling pathway; leukemia inhibitory factor signaling pathway; negative regulation of apoptosis; positive regulation of acute inflammatory response; positive regulation of adaptive immune response; positive regulation of cell proliferation; positive regulation of osteoblast differentiation; positive regulation of T cell proliferation; positive regulation of tyrosine phosphorylation of Stat1 protein; positive regulation of tyrosine phosphorylation of Stat3 protein; response to cytokine stimulus

Research Articles on IL6ST

Similar Products

Product Notes

The IL6ST il6st (Catalog #AAA1271170) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgttgacgt tgcagacttg gctagtgcaa gccttgttta ttttcctcac cactgaatct acaggtgaac ttctagatcc atgtggttat atcagtcctg aatctccagt tgtacaactt cattctaatt tcactgcagt ttgtgtgcta aaggaaaaat gtatggatta ttttcatgta aatgctaatt acattgtctg gaaaacaaac cattttacta ttcctaagga gcaatatact atcataaaca gaacagcatc cagtgtcacc tttacagata tagcttcatt aaatattcag ctcacttgca acattcttac attcggacag cttgaacaga atgtttatgg aatcacaata atttcaggct tgcctccaga aaaacctaaa aatttgagtt gcattgtgaa cgaggggaag aaaatgaggt gtgagtggga tcgtggaagg gaaacacact tggagacaaa cttcacttta aaatctgaat gggcaacaca caagtttgct gattgcaaag caaaacgtga cacccccacc tcatgcactg ttgattattc tactgtgtat tttgtcaaca ttgaagtctg ggtagaagca gagaatgccc ttgggaaggt tacatcagat catatcaatt ttgatcctgt atataaagtg aagcccaatc cgccacataa tttatcagtg atcaactcag aggaactgtc tagtatctta aaattgacat ggaccaaccc aagtattaag agtgttataa tactaaaata taacattcaa tataggacca aagatgcctc aacttggagc cagattcctc ctgaagacac agcatccacc cgatcttcat tcactgtcca agaccttaaa ccttttacag aatatgtgtt taggattcgc tgtatgaagg aagatggtaa gggatactgg agtgactgga gtgaagaagc aagtgggatc acctatgaag atagaccatc taaagcacca agtttctggt ataaaataga tccatcccat actcaaggct acagaactgt acaactcgtg tggaagacat tgcctccttt tgaagccaat ggaaaaatct tggattatga agtgactctc acaagatgga aatcacattt acaaaattac acagttaatg ccacaaaact gacagtaaat ctcacaaatg atcgctatgt agcaacccta acagtaagaa atcttgttgg caaatcagat gcagctgttt taactatccc tgcctgtgac tttcaagcta ctcaccctgt aatggatctt aaagcattcc ccaaagataa catgctttgg gtggaatgga ctactccaag ggaatctgta aagaaatata tacttgagtg gtgtgtgtta tcagataaag caccctgtat cacagactgg caacaagaag atggtaccgt gcatcgcacc tatttaagag ggaacttagc agagagcaaa tgctatttga taacagttac tccagtatat gctgatggac caggaagccc tgaatccata aaggcatacc ttaaacaagc tccaccttcc aaaggaccta ctgttcggac aaaaaaagta gggaaaaacg aagctgtctt agagtgggac caacttcctg ttgatgttca gaatggattt atcagaaatt atactatatt ttatagaacc atcattggaa atgaaactgc tgtgaatgtg gattcttccc acacagaata tacattgtcc tctttgacta gtgacacatt gtacatggta cgaatggcag catacacaga tgaaggtggg aaggatggtc cagaattcac ttttactacc ccaaagtttg ctcaaggaga aattgaagcc atagtcgtgc ctgtttgctt agcattccta ttgacaactc ttctgggagt gctgttctgc tttaataagc gagacctaat taaaaaacac atctggccta atgttccaga tccttcaaag agtcatattg cccagtggtc acctcacact cctccaaggc acaattttaa ttcaaaagat caaatgtatt cagatggcaa tttcactgat gtaagtgttg tggaaataga agcaaatgac aaaaagcctt ttccagaaga tctgaaatca ttggacctgt tcaaaaagga aaaaattaat actgaaggac acagcagtgg tattgggggg tcttcatgca tgtcatcttc taggccaagc atttctagca gtgatgaaaa tgaatcttca caaaacactt cgagcactgt ccagtattct accgtggtac acagtggcta cagacaccaa gttccgtcag tccaagtctt ctcaagatcc gagtctaccc agcccttgtt agattcagag gagcggccag aagatctaca attagtagat catgtagatg gcggtgatgg tattttgccc aggcaacagt acttcaaaca gaactgcagt cagcatgaat ccagtccaga tatttcacat tttgaaaggt caaagcaagt ttcatcagtc aatgaggaag attttgttag acttaaacag cagatttcag atcatatttc acaatcctgt ggatctgggc aaatgaaaat gtttcaggaa gtttctgcag cagatgcttt tggtccaggt actgagggac aagtagaaag atttgaaaca gttggcatgg aggctgcgac tgatgaaggc atgcctaaaa gttacttacc acagactgta cggcaaggcg gctacatgcc tcagtga. It is sometimes possible for the material contained within the vial of "IL6ST, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.