Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

IL6R cdna clone

IL6R cDNA Clone

Gene Names
IL6R; IL6Q; gp80; CD126; IL6RA; IL6RQ; IL-6RA; IL-6R-1
Synonyms
IL6R; IL6R cDNA Clone; IL6R cdna clone
Ordering
For Research Use Only!
Sequence
atgctggccgtcggctgcgcgctgctggctgccctgctggccgcgccgggagcggcgctggccccaaggcgctgccctgcgcaggaggtggcgagaggcgtgctgaccagtctgccaggagacagcgtgactctgacctgcccgggggtagagccggaagacaatgccactgttcactgggtgctcaggaagccggctgcaggctcccaccccagcagatgggctggcatgggaaggaggctgctgctgaggtcggtgcagctccacgactctggaaactattcatgctaccgggccggccgcccagctgggactgtgcacttgctggtggatgttccccccgaggagccccagctctcctgcttccggaagagccccctcagcaatgttgtttgtgagtggggtcctcggagcaccccatccctgacgacaaaggctgtgctcttggtgaggaagtttcagaacagtccggccgaagacttccaggagccgtgccagtattcccaggagtcccagaagttctcctgccagttagcagtcccggagggagacagctctttctacatagtgtccatgtgcgtcgccagtagtgtcgggagcaagttcagcaaaactcaaacctttcagggttgtggaatcttgcagcctgatccgcctgccaacatcacagtcactgccgtggccagaaacccccgctggctcagtgtcacctggcaagacccccactcctggaactcatctttctacagactacggtttgagctcagatatcgggctgaacggtcaaagacattcacaacatggatggtcaaggacctccagcatcactgtgtcatccacgacgcctggagcggcctgaggcacgtggtgcagcttcgtgcccaggaggagttcgggcaaggcgagtggagcgagtggagcccggaggccatgggcacgccttggacagaatccaggagtcctccagctgagaacgaggtgtccacccccatgcaggcacttactactaataaagacgatgataatattctcttcagagattctgcaaatgcgacaagcctcccagtgcaagattcttcttcagtaccactgcccacattcctggttgctggagggagcctggccttcggaacgctcctctgcattgccattgttctgaggttcaagaagacgtggaagctgcgggctctgaaggaaggcaagacaagcatgcatccgccgtactctttggggcagctggtcccggagaggcctcgacccaccccagtgcttgttcctctcatctccccaccggtgtcccccagcagcctggggtctgacaatacctcgagccacaaccgaccagatgccagggacccacggagcccttatgacatcagcaatacagactacttcttccccagatag
Sequence Length
1407
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
40,237 Da
NCBI Official Full Name
Homo sapiens interleukin 6 receptor, mRNA
NCBI Official Synonym Full Names
interleukin 6 receptor
NCBI Official Symbol
IL6R
NCBI Official Synonym Symbols
IL6Q; gp80; CD126; IL6RA; IL6RQ; IL-6RA; IL-6R-1
NCBI Protein Information
interleukin-6 receptor subunit alpha
UniProt Protein Name
Interleukin-6 receptor subunit alpha
Protein Family
UniProt Gene Name
IL6R
UniProt Synonym Gene Names
IL-6 receptor subunit alpha; IL-6R subunit alpha; IL-6R-alpha; IL-6RA; gp80
UniProt Entry Name
IL6RA_HUMAN

NCBI Description

This gene encodes a subunit of the interleukin 6 (IL6) receptor complex. Interleukin 6 is a potent pleiotropic cytokine that regulates cell growth and differentiation and plays an important role in the immune response. The IL6 receptor is a protein complex consisting of this protein and interleukin 6 signal transducer (IL6ST/GP130/IL6-beta), a receptor subunit also shared by many other cytokines. Dysregulated production of IL6 and this receptor are implicated in the pathogenesis of many diseases, such as multiple myeloma, autoimmune diseases and prostate cancer. Alternatively spliced transcript variants encoding distinct isoforms have been reported. A pseudogene of this gene is found on chromosome 9.[provided by RefSeq, May 2011]

Uniprot Description

IL6R: Part of the receptor for interleukin 6. Binds to IL6 with low affinity, but does not transduce a signal. Signal activation necessitate an association with IL6ST. Activation may lead to the regulation of the immune response, acute-phase reactions and hematopoiesis. Belongs to the type I cytokine receptor family. Type 3 subfamily. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, integral; Receptor, cytokine

Chromosomal Location of Human Ortholog: 1q21

Cellular Component: apical plasma membrane; extracellular region; interleukin-6 receptor complex; plasma membrane

Molecular Function: ciliary neurotrophic factor receptor activity; enzyme binding; interleukin-6 binding; interleukin-6 receptor activity; interleukin-6 receptor binding; protein binding; protein homodimerization activity

Biological Process: acute-phase response; cytokine and chemokine mediated signaling pathway; defense response to Gram-negative bacterium; endocrine pancreas development; hepatic immune response; monocyte chemotaxis; positive regulation of cell proliferation; positive regulation of chemokine production; positive regulation of interleukin-6 production; positive regulation of leukocyte chemotaxis; positive regulation of osteoblast differentiation; positive regulation of peptidyl-tyrosine phosphorylation; positive regulation of smooth muscle cell proliferation; positive regulation of tyrosine phosphorylation of Stat3 protein; response to cytokine stimulus

Disease: Interleukin 6, Serum Level Of, Quantitative Trait Locus; Soluble Interleukin-6 Receptor, Serum Level Of, Quantitative Trait Locus

Research Articles on IL6R

Similar Products

Product Notes

The IL6R il6r (Catalog #AAA1268395) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctggccg tcggctgcgc gctgctggct gccctgctgg ccgcgccggg agcggcgctg gccccaaggc gctgccctgc gcaggaggtg gcgagaggcg tgctgaccag tctgccagga gacagcgtga ctctgacctg cccgggggta gagccggaag acaatgccac tgttcactgg gtgctcagga agccggctgc aggctcccac cccagcagat gggctggcat gggaaggagg ctgctgctga ggtcggtgca gctccacgac tctggaaact attcatgcta ccgggccggc cgcccagctg ggactgtgca cttgctggtg gatgttcccc ccgaggagcc ccagctctcc tgcttccgga agagccccct cagcaatgtt gtttgtgagt ggggtcctcg gagcacccca tccctgacga caaaggctgt gctcttggtg aggaagtttc agaacagtcc ggccgaagac ttccaggagc cgtgccagta ttcccaggag tcccagaagt tctcctgcca gttagcagtc ccggagggag acagctcttt ctacatagtg tccatgtgcg tcgccagtag tgtcgggagc aagttcagca aaactcaaac ctttcagggt tgtggaatct tgcagcctga tccgcctgcc aacatcacag tcactgccgt ggccagaaac ccccgctggc tcagtgtcac ctggcaagac ccccactcct ggaactcatc tttctacaga ctacggtttg agctcagata tcgggctgaa cggtcaaaga cattcacaac atggatggtc aaggacctcc agcatcactg tgtcatccac gacgcctgga gcggcctgag gcacgtggtg cagcttcgtg cccaggagga gttcgggcaa ggcgagtgga gcgagtggag cccggaggcc atgggcacgc cttggacaga atccaggagt cctccagctg agaacgaggt gtccaccccc atgcaggcac ttactactaa taaagacgat gataatattc tcttcagaga ttctgcaaat gcgacaagcc tcccagtgca agattcttct tcagtaccac tgcccacatt cctggttgct ggagggagcc tggccttcgg aacgctcctc tgcattgcca ttgttctgag gttcaagaag acgtggaagc tgcgggctct gaaggaaggc aagacaagca tgcatccgcc gtactctttg gggcagctgg tcccggagag gcctcgaccc accccagtgc ttgttcctct catctcccca ccggtgtccc ccagcagcct ggggtctgac aatacctcga gccacaaccg accagatgcc agggacccac ggagccctta tgacatcagc aatacagact acttcttccc cagatag. It is sometimes possible for the material contained within the vial of "IL6R, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.