Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

IL2RG cdna clone

IL2RG cDNA Clone

Gene Names
IL2RG; P64; CIDX; IMD4; CD132; SCIDX; IL-2RG; SCIDX1
Synonyms
IL2RG; IL2RG cDNA Clone; IL2RG cdna clone
Ordering
For Research Use Only!
Sequence
atgttgaagccatcattaccattcacatccctcttattcctgcagctgcccctgctgggagtggggctgaacacgacaattctgacgcccaatgggaatgaagacaccacagctgatttcttcctgaccactatgcccactgactccctcagtgtttccactctgcccctcccagaggttcagtgttttgtgttcaatgtcgagtacatgaattgcacttggaacagcagctctgagccccagcctaccaacctcactctgcattattggtacaagaactcggataatgataaagtccagaagtgcagccactatctattctctgaagaaatcacttctggctgtcagttgcaaaaaaaggagatccacctctaccaaacatttgttgttcagctccaggacccacgggaacccaggagacaggccacacagatgctaaaactgcagaatctggtgatcccctgggctccagagaacctaacacttcacaaactgagtgaatcccagctagaactgaactggaacaacagattcttgaaccactgtttggagcacttggtgcagtaccggactgactgggaccacagctggactgaacaatcagtggattatagacataagttctccttgcctagtgtggatgggcagaaacgctacacgtttcgtgttcggagccgctttaacccactctgtggaagtgctcagcattggagtgaatggagccacccaatccactgggggagcaatacttcaaaagagaatcctttcctgtttgcattggaagccgtggttatctctgttggctccatgggattgattatcagccttctctgtgtgtatttctggctggaacggacgatgccccgaattcccaccctgaagaacctagaggatcttgttactgaataccacgggaacttttcggcctggagtggtgtgtctaagggactggctgagagtctgcagccagactacagtgaacgactctgcctcgtcagtgagattcccccaaaaggaggggcccttggggaggggcctggggcctccccatgcaaccagcatagcccctactgggcccccccatgttacaccctaaagcctgaaacctga
Sequence Length
1110
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
20,088 Da
NCBI Official Full Name
Homo sapiens interleukin 2 receptor, gamma (severe combined immunodeficiency), mRNA
NCBI Official Synonym Full Names
interleukin 2 receptor subunit gamma
NCBI Official Symbol
IL2RG
NCBI Official Synonym Symbols
P64; CIDX; IMD4; CD132; SCIDX; IL-2RG; SCIDX1
NCBI Protein Information
cytokine receptor common subunit gamma
UniProt Protein Name
Cytokine receptor common subunit gamma
Protein Family
UniProt Gene Name
IL2RG
UniProt Synonym Gene Names
IL-2 receptor subunit gamma; IL-2R subunit gamma; IL-2RG
UniProt Entry Name
IL2RG_HUMAN

NCBI Description

The protein encoded by this gene is an important signaling component of many interleukin receptors, including those of interleukin -2, -4, -7 and -21, and is thus referred to as the common gamma chain. Mutations in this gene cause X-linked severe combined immunodeficiency (XSCID), as well as X-linked combined immunodeficiency (XCID), a less severe immunodeficiency disorder. [provided by RefSeq, Mar 2010]

Uniprot Description

IL2RG: Common subunit for the receptors for a variety of interleukins. Defects in IL2RG are the cause of severe combined immunodeficiency X-linked T-cell-negative/B-cell-positive/NK-cell- negative (XSCID); also known as agammaglobulinemia Swiss type. A form of severe combined immunodeficiency (SCID), a genetically and clinically heterogeneous group of rare congenital disorders characterized by impairment of both humoral and cell- mediated immunity, leukopenia, and low or absent antibody levels. Patients present in infancy recurrent, persistent infections by opportunistic organisms. The common characteristic of all types of SCID is absence of T-cell-mediated cellular immunity due to a defect in T-cell development. Defects in IL2RG are the cause of X-linked combined immunodeficiency (XCID). XCID is a less severe form of X-linked immunodeficiency with a less severe degree of deficiency in cellular and humoral immunity than that seen in XSCID. Belongs to the type I cytokine receptor family. Type 5 subfamily.

Protein type: Membrane protein, integral; Receptor, cytokine

Chromosomal Location of Human Ortholog: Xq13.1

Cellular Component: external side of plasma membrane; integral to plasma membrane; membrane; plasma membrane

Molecular Function: interleukin-2 binding; interleukin-2 receptor activity; interleukin-4 receptor activity; interleukin-7 receptor activity; protein binding; Ras guanyl-nucleotide exchange factor activity

Biological Process: immune response; MAPKKK cascade

Disease: Combined Immunodeficiency, X-linked; Severe Combined Immunodeficiency, X-linked

Research Articles on IL2RG

Similar Products

Product Notes

The IL2RG il2rg (Catalog #AAA1268469) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgttgaagc catcattacc attcacatcc ctcttattcc tgcagctgcc cctgctggga gtggggctga acacgacaat tctgacgccc aatgggaatg aagacaccac agctgatttc ttcctgacca ctatgcccac tgactccctc agtgtttcca ctctgcccct cccagaggtt cagtgttttg tgttcaatgt cgagtacatg aattgcactt ggaacagcag ctctgagccc cagcctacca acctcactct gcattattgg tacaagaact cggataatga taaagtccag aagtgcagcc actatctatt ctctgaagaa atcacttctg gctgtcagtt gcaaaaaaag gagatccacc tctaccaaac atttgttgtt cagctccagg acccacggga acccaggaga caggccacac agatgctaaa actgcagaat ctggtgatcc cctgggctcc agagaaccta acacttcaca aactgagtga atcccagcta gaactgaact ggaacaacag attcttgaac cactgtttgg agcacttggt gcagtaccgg actgactggg accacagctg gactgaacaa tcagtggatt atagacataa gttctccttg cctagtgtgg atgggcagaa acgctacacg tttcgtgttc ggagccgctt taacccactc tgtggaagtg ctcagcattg gagtgaatgg agccacccaa tccactgggg gagcaatact tcaaaagaga atcctttcct gtttgcattg gaagccgtgg ttatctctgt tggctccatg ggattgatta tcagccttct ctgtgtgtat ttctggctgg aacggacgat gccccgaatt cccaccctga agaacctaga ggatcttgtt actgaatacc acgggaactt ttcggcctgg agtggtgtgt ctaagggact ggctgagagt ctgcagccag actacagtga acgactctgc ctcgtcagtg agattccccc aaaaggaggg gcccttgggg aggggcctgg ggcctcccca tgcaaccagc atagccccta ctgggccccc ccatgttaca ccctaaagcc tgaaacctga. It is sometimes possible for the material contained within the vial of "IL2RG, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.