Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

IL28A cdna clone

IL28A cDNA Clone

Gene Names
IFNL2; IL28A; IL-28A
Synonyms
IL28A; IL28A cDNA Clone; IL28A cdna clone
Ordering
For Research Use Only!
Sequence
atgaaactagacatgactggggactgcacgccagtgctggtgctgatggccgcagtgctgaccgtgactggagcagttcctgtcgccaggctccacggggctctcccggatgcaaggggctgccacatagcccagttcaagtccctgtctccacaggagctgcaggcctttaagagggccaaagatgccttagaagagtcgcttctgctgaaggactgcaggtgccactcccgcctcttccccaggacctgggacctgaggcagctgcaggtgagggagcgccccatggctttggaggctgagctggccctgacgctgaaggttctggaggccaccgctgacactgacccagccctggtggacgtcttggaccagccccttcacaccctgcaccatatcctctcccagttccgggcctgtatccagcctcagcccacggcagggcccaggacccggggccgcctccaccattggctgtaccggctccaggaggccccaaaaaaggagtcccctggctgcctcgaggcctctgtcaccttcaacctcttccgcctcctcacgcgagacctgaattgtgttgccagtggggacctgtgtgtctga
Sequence Length
603
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
22,288 Da
NCBI Official Full Name
Homo sapiens interleukin 28A (interferon, lambda 2), mRNA
NCBI Official Synonym Full Names
interferon lambda 2
NCBI Official Symbol
IFNL2
NCBI Official Synonym Symbols
IL28A; IL-28A
NCBI Protein Information
interferon lambda-2
UniProt Protein Name
Interferon lambda-2
UniProt Gene Name
IFNL2
UniProt Synonym Gene Names
IL28A; ZCYTO20; IFN-lambda-2; IL-28A
UniProt Entry Name
IFNL2_HUMAN

NCBI Description

This gene encodes a cytokine distantly related to type I interferons and the IL-10 family. This gene, interleukin 28B (IL28B), and interleukin 29 (IL29) are three closely related cytokine genes that form a cytokine gene cluster on a chromosomal region mapped to 19q13. Expression of the cytokines encoded by the three genes can be induced by viral infection. All three cytokines have been shown to interact with a heterodimeric class II cytokine receptor that consists of interleukin 10 receptor, beta (IL10RB) and interleukin 28 receptor, alpha (IL28RA). [provided by RefSeq, Jul 2008]

Uniprot Description

IL28A: Cytokine with immunomodulatory activity. Up-regulates MHC class I antigen expression. Displays potent antiviral activity. Also displays antitumor activity. Ligand for the heterodimeric class II cytokine receptor composed of IL10RB and IL28RA. The ligand/receptor complex seems to signal through the Jak-STAT pathway. Belongs to the IL-28/IL-29 family.

Protein type: Secreted, signal peptide; Cytokine; Secreted

Chromosomal Location of Human Ortholog: 19q13.13

Cellular Component: extracellular region; extracellular space

Molecular Function: receptor binding

Biological Process: defense response to virus; innate immune response; mucosal immune response; regulation of T cell activation

Research Articles on IL28A

Similar Products

Product Notes

The IL28A ifnl2 (Catalog #AAA1276045) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaaactag acatgactgg ggactgcacg ccagtgctgg tgctgatggc cgcagtgctg accgtgactg gagcagttcc tgtcgccagg ctccacgggg ctctcccgga tgcaaggggc tgccacatag cccagttcaa gtccctgtct ccacaggagc tgcaggcctt taagagggcc aaagatgcct tagaagagtc gcttctgctg aaggactgca ggtgccactc ccgcctcttc cccaggacct gggacctgag gcagctgcag gtgagggagc gccccatggc tttggaggct gagctggccc tgacgctgaa ggttctggag gccaccgctg acactgaccc agccctggtg gacgtcttgg accagcccct tcacaccctg caccatatcc tctcccagtt ccgggcctgt atccagcctc agcccacggc agggcccagg acccggggcc gcctccacca ttggctgtac cggctccagg aggccccaaa aaaggagtcc cctggctgcc tcgaggcctc tgtcaccttc aacctcttcc gcctcctcac gcgagacctg aattgtgttg ccagtgggga cctgtgtgtc tga. It is sometimes possible for the material contained within the vial of "IL28A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.