Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

IL26 cdna clone

IL26 cDNA Clone

Gene Names
IL26; AK155; IL-26
Synonyms
IL26; IL26 cDNA Clone; IL26 cdna clone
Ordering
For Research Use Only!
Sequence
atgctggtgaatttcattttgaggtgtgggttgctgttagtcactctgtctcttgccattgccaagcacaagcaatcttccttcaccaaaagttgttacccaaggggaacattgtcccaagctgttgacgctctctatatcaaagcagcatggctcaaagcaacgattccagaagaccgcataaaaaatatacgattattaaaaaagaaaacaaaaaagcagtttatgaaaaactgtcaatttcaagaacagcttctgtccttcttcatggaagacgtttttggtcaactgcaattgcaaggctgcaagaaaatacgctttgtggaggactttcatagccttaggcagaaattgagccactgtatttcctgtgcttcatcagctagagagatgaaatccattaccaggatgaaaagaatattttataggattggaaacaaaggaatctacaaagccatcagtgaactggatattcttctttcctggattaaaaaattattggaaagcagtcagtaa
Sequence Length
516
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
19,843 Da
NCBI Official Full Name
Homo sapiens interleukin 26, mRNA
NCBI Official Synonym Full Names
interleukin 26
NCBI Official Symbol
IL26
NCBI Official Synonym Symbols
AK155; IL-26
NCBI Protein Information
interleukin-26
UniProt Protein Name
Interleukin-26
Protein Family
UniProt Gene Name
IL26
UniProt Synonym Gene Names
AK155; IL-26
UniProt Entry Name
IL26_HUMAN

NCBI Description

This gene was identified by its overexpression specifically in herpesvirus samimiri-transformed T cells. The encoded protein is a member of the IL10 family of cytokines. It is a secreted protein and may function as a homodimer. This protein is thought to contribute to the transformed phenotype of T cells after infection by herpesvirus samimiri. [provided by RefSeq, Jul 2008]

Uniprot Description

IL26: May play a role in local mechanisms of mucosal immunity and seems to have a proinflammatory function. May play a role in inflammatory bowel disease. Activates STAT1 and STAT3, MAPK1/3 (ERK1/2), JUN and AKT. Induces expression of SOCS3, TNF-alpha and IL-8, secretion of IL-8 and IL-10 and surface expression of ICAM1. Decreases proliferation of intestinal epithelial cells. Is inhibited by heparin. Belongs to the IL-10 family.

Protein type: Secreted, signal peptide; Cytokine; Secreted

Chromosomal Location of Human Ortholog: 12q15

Cellular Component: cytosol; extracellular space

Molecular Function: cytokine activity

Biological Process: cell-cell signaling; immune response; inflammatory response; negative regulation of epithelial cell proliferation; positive regulation of cytokine secretion; positive regulation of JAK-STAT cascade; positive regulation of protein kinase B signaling cascade; positive regulation of stress-activated MAPK cascade; positive regulation of transcription from RNA polymerase II promoter

Research Articles on IL26

Similar Products

Product Notes

The IL26 il26 (Catalog #AAA1275020) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctggtga atttcatttt gaggtgtggg ttgctgttag tcactctgtc tcttgccatt gccaagcaca agcaatcttc cttcaccaaa agttgttacc caaggggaac attgtcccaa gctgttgacg ctctctatat caaagcagca tggctcaaag caacgattcc agaagaccgc ataaaaaata tacgattatt aaaaaagaaa acaaaaaagc agtttatgaa aaactgtcaa tttcaagaac agcttctgtc cttcttcatg gaagacgttt ttggtcaact gcaattgcaa ggctgcaaga aaatacgctt tgtggaggac tttcatagcc ttaggcagaa attgagccac tgtatttcct gtgcttcatc agctagagag atgaaatcca ttaccaggat gaaaagaata ttttatagga ttggaaacaa aggaatctac aaagccatca gtgaactgga tattcttctt tcctggatta aaaaattatt ggaaagcagt cagtaa. It is sometimes possible for the material contained within the vial of "IL26, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.