IL22RA2 cdna clone
IL22RA2 cDNA Clone
Synonyms
IL22RA2; IL22RA2 cDNA Clone; IL22RA2 cdna clone
Sequence
ATGATGCCTAAACATTGCTTTCTAGGCTTCCTCATCAGTTTCTTCCTTACTGGTGTAGCAGGAACTCAGTCAACGCATGAGTCTCTGAAGCCTCAGAGGGTACAATTTCAGTCCCGAAATTTTCACAACATTTTGCAATGGCAGCCTGGGAGGGCACTTACTGGCAACAGCAGTGTCTATTTTGTGCAGTACAAAATATATGGACAGAGACAATGGAAAAATAAAGAAGACTGTTGGGGTACTCAAGAACTCTCTTGTGACCTTACCAGTGAAACCTCAGACATACAGGAACCTTATTACGGGAGGGTGAGGGCGGCCTCGGCTGGGAGCTACTCAGAATGGAGCATGACGCCGCGGTTCACTCCCTGGTGGGAAACAAAAATAGATCCTCCAGTCATGAATATAACCCAAGTCAATGGCTCTTTGTTGGTAATTCTCCATGCTCCAAATTTACCATATAGATACCAAAAGGAAAAAAATGTATCTATAGAAGATTACTATGAACTACTATACCGAGTTTTTATAATTAACAATTCACTAGAAAAGGAGCAAAAGGTTTATGAAGGGGCTCACAGAGCGGTTGAAATTGAAGCTCTAACACCACACTCCAGCTACTGTGTAGTGGCTGAAATATATCAGCCCATGTTAGACAGAAGAAGTCAGAGAAGTGAAGAGAGATGTGTGGAAATTCCATGA
Sequence Length
696
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
15,128 Da
NCBI Official Full Name
Homo sapiens interleukin 22 receptor, alpha 2, mRNA
UniProt Protein Name
Interleukin-22 receptor subunit alpha-2
Protein Family
UniProt Gene Name
IL22RA2
UniProt Synonym Gene Names
IL-22 receptor subunit alpha-2; IL-22R-alpha-2; IL-22RA2; CRF2-10; CRF2-S1; IL-22BP; IL22BP
UniProt Entry Name
I22R2_HUMAN
Uniprot Description
IL22RA2: Isoform 2 is a receptor for IL22. Binds to IL22, prevents interaction with the functional IL-22R complex and blocks the activity of IL22 (in vitro). May play an important role as an IL22 antagonist in the regulation of inflammatory responses. Belongs to the type II cytokine receptor family. 3 isoforms of the human protein are produced by alternative splicing.
Protein type: Secreted; Secreted, signal peptide
Chromosomal Location of Human Ortholog: 6q23.3
Cellular Component: extracellular region; integral to membrane; plasma membrane
Molecular Function: interleukin-22 binding; interleukin-22 receptor activity
Biological Process: regulation of tyrosine phosphorylation of Stat3 protein
Similar Products
Product Notes
The IL22RA2 il22ra2 (Catalog #AAA1271789) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: ATGATGCCTA AACATTGCTT TCTAGGCTTC CTCATCAGTT TCTTCCTTAC TGGTGTAGCA GGAACTCAGT CAACGCATGA GTCTCTGAAG CCTCAGAGGG TACAATTTCA GTCCCGAAAT TTTCACAACA TTTTGCAATG GCAGCCTGGG AGGGCACTTA CTGGCAACAG CAGTGTCTAT TTTGTGCAGT ACAAAATATA TGGACAGAGA CAATGGAAAA ATAAAGAAGA CTGTTGGGGT ACTCAAGAAC TCTCTTGTGA CCTTACCAGT GAAACCTCAG ACATACAGGA ACCTTATTAC GGGAGGGTGA GGGCGGCCTC GGCTGGGAGC TACTCAGAAT GGAGCATGAC GCCGCGGTTC ACTCCCTGGT GGGAAACAAA AATAGATCCT CCAGTCATGA ATATAACCCA AGTCAATGGC TCTTTGTTGG TAATTCTCCA TGCTCCAAAT TTACCATATA GATACCAAAA GGAAAAAAAT GTATCTATAG AAGATTACTA TGAACTACTA TACCGAGTTT TTATAATTAA CAATTCACTA GAAAAGGAGC AAAAGGTTTA TGAAGGGGCT CACAGAGCGG TTGAAATTGA AGCTCTAACA CCACACTCCA GCTACTGTGT AGTGGCTGAA ATATATCAGC CCATGTTAGA CAGAAGAAGT CAGAGAAGTG AAGAGAGATG TGTGGAAATT CCATGA. It is sometimes possible for the material contained within the vial of "IL22RA2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
