IL1RAPL1 cdna clone
IL1RAPL1 cDNA Clone
Synonyms
IL1RAPL1; IL1RAPL1 cDNA Clone; IL1RAPL1 cdna clone
Sequence
atgaaagctccgattccacacttgattctcttatacgctacttttactcagagtttgaaggttgtgaccaaaagaggctccgccgatggatgcactgactggtctatcgatatcaagaaatatcaagttttggtgggagagcctgttcgaatcaaatgtgcactcttttatggttatatcagaacaaattactcccttgcccaaagtgctggactcagtttgatgtggtacaaaagttctggtcctggagactttgaagagccaatagcctttgacggaagtagaatgagcaaagaagaagactccatttggttccggccaacattgctacaggacagtggtctctacgcctgtgtcatcagaaactccacttactgtatgaaagtatccatctcactgacagtgggtgaaaatgacactggactctgctataattccaagatgaagtattttgaaaaagctgaacttagcaaaagcaaggaaatttcatgccgtgacatagaggattttctactgccaaccagagaacctgaaatcctttggtacaaggaatgcaggacaaaaacatggaggccaagtattgtattcaaaagagatactctgcttataagagaagtcagagaagatgacattggaaattatacctgtgaattaaaatatggaggctttgttgtgagaagaactactgaattaactgttacagcccctctgactgataagccacccaagcttttgtatcctatggaaagtaaactgacaattcaggagacccagctgggtgactctgctaatctaacctgcagagctttctttgggtacagcggagatgtcagtcctttaatttactggatgaaaggagaaaaatttattgaagatctggatgaaaatcgagtttgggaaagtgacattagaattcttaaggagcatcttggggaacaggaagtttccatctcattaattgtggactctgtggaagaaggtgacttgggaaattactcctgttatgttgaaaatggaaatggacgtcgacacgccagcgttctccttcataaacgagagctaatgtacacagtggaacttgctggaggccttggtgctatactcttgctgcttgtatgtttggtgaccatctacaagtgttacaagatagaaatcatgctcttctacaggaatcattttggagctgaagagctcgatggagacaataaagattatgatgcatacttatcatacaccaaagtggatcctgaccagtggaatcaagagactggggaagaagaacgttttgcccttgaaatcctacctgatatgcttgaaaagcattatggatataagttgtttataccagatagagatttaatcccaactggaacatacattgaagatgtggcaagatgtgtagatcaaagcaagcggctgattattgtcatgaccccaaattacgtagttagaaggggctggagcatctttgagctggaaaccagacttcgaaatatgcttgtgactggagaaattaaagtgattctaattgaatgcagtgaactgagaggaattatgaactaccaggaggtggaggccctgaagcacaccatcaagctcctgacggtcattaaatggcatggaccaaaatgcaacaagttgaactccaagttctggaaacgtttacagtatgaaatgccttttaagaggatagaacccattacacatgagcaggctttagatgtcagtgagcaagggccttttggggagctgcagactgtctcggccatttccatggccgcggccacctccacagctctagccactgcccatccagatctccgttctacctttcacaacacgtaccattcacaaatgcgtcagaaacactactaccgaagctatgagtacgacgtacctcctaccggcaccctgcctcttacctccataggcaatcagcatacctactgtaacatccctatgacactcatcaacgggcagcggccacagacaaaatcgagcagggagcagaatccagatgaggcccacacaaacagtgccatcctgccgctgttgccaagggagaccagtatatccagtgtgatatggtga
Sequence Length
2091
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
79,969 Da
NCBI Official Full Name
Homo sapiens interleukin 1 receptor accessory protein-like 1, mRNA
UniProt Protein Name
Interleukin-1 receptor accessory protein-like 1
Protein Family
UniProt Gene Name
IL1RAPL1
UniProt Synonym Gene Names
OPHN4; IL-1-RAPL-1; IL-1RAPL-1; IL1RAPL-1; TIGIRR-2
UniProt Entry Name
IRPL1_HUMAN
Uniprot Description
IL1RAPL1: May regulate secretion and presynaptic differentiation through inhibition of the activity of N-type voltage-gated calcium channel. May activate the MAP kinase JNK. Plays a role in presynaptic and postsynaptic differentiation and dendritic spine formation in neurons. Defects in IL1RAPL1 are the cause of mental retardation X-linked type 21 (MRX21). Mental retardation is a mental disorder characterized by significantly sub-average general intellectual functioning associated with impairments in adaptative behavior and manifested during the developmental period. Non- syndromic mental retardation patients do not manifest other clinical signs. Belongs to the interleukin-1 receptor family. 1 isoforms of the human protein are produced by alternative splicing.
Protein type: Membrane protein, integral; Receptor, misc.
Chromosomal Location of Human Ortholog: Xp22.1-p21.3
Cellular Component: cell surface; dendrite; plasma membrane
Molecular Function: interleukin-1 binding; protein binding; receptor binding; voltage-gated calcium channel activity
Biological Process: heterophilic cell adhesion; negative regulation of exocytosis; neuron differentiation; positive regulation of dendrite morphogenesis
Disease: Mental Retardation, X-linked 21
Similar Products
Product Notes
The IL1RAPL1 il1rapl1 (Catalog #AAA1277890) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaaagctc cgattccaca cttgattctc ttatacgcta cttttactca gagtttgaag gttgtgacca aaagaggctc cgccgatgga tgcactgact ggtctatcga tatcaagaaa tatcaagttt tggtgggaga gcctgttcga atcaaatgtg cactctttta tggttatatc agaacaaatt actcccttgc ccaaagtgct ggactcagtt tgatgtggta caaaagttct ggtcctggag actttgaaga gccaatagcc tttgacggaa gtagaatgag caaagaagaa gactccattt ggttccggcc aacattgcta caggacagtg gtctctacgc ctgtgtcatc agaaactcca cttactgtat gaaagtatcc atctcactga cagtgggtga aaatgacact ggactctgct ataattccaa gatgaagtat tttgaaaaag ctgaacttag caaaagcaag gaaatttcat gccgtgacat agaggatttt ctactgccaa ccagagaacc tgaaatcctt tggtacaagg aatgcaggac aaaaacatgg aggccaagta ttgtattcaa aagagatact ctgcttataa gagaagtcag agaagatgac attggaaatt atacctgtga attaaaatat ggaggctttg ttgtgagaag aactactgaa ttaactgtta cagcccctct gactgataag ccacccaagc ttttgtatcc tatggaaagt aaactgacaa ttcaggagac ccagctgggt gactctgcta atctaacctg cagagctttc tttgggtaca gcggagatgt cagtccttta atttactgga tgaaaggaga aaaatttatt gaagatctgg atgaaaatcg agtttgggaa agtgacatta gaattcttaa ggagcatctt ggggaacagg aagtttccat ctcattaatt gtggactctg tggaagaagg tgacttggga aattactcct gttatgttga aaatggaaat ggacgtcgac acgccagcgt tctccttcat aaacgagagc taatgtacac agtggaactt gctggaggcc ttggtgctat actcttgctg cttgtatgtt tggtgaccat ctacaagtgt tacaagatag aaatcatgct cttctacagg aatcattttg gagctgaaga gctcgatgga gacaataaag attatgatgc atacttatca tacaccaaag tggatcctga ccagtggaat caagagactg gggaagaaga acgttttgcc cttgaaatcc tacctgatat gcttgaaaag cattatggat ataagttgtt tataccagat agagatttaa tcccaactgg aacatacatt gaagatgtgg caagatgtgt agatcaaagc aagcggctga ttattgtcat gaccccaaat tacgtagtta gaaggggctg gagcatcttt gagctggaaa ccagacttcg aaatatgctt gtgactggag aaattaaagt gattctaatt gaatgcagtg aactgagagg aattatgaac taccaggagg tggaggccct gaagcacacc atcaagctcc tgacggtcat taaatggcat ggaccaaaat gcaacaagtt gaactccaag ttctggaaac gtttacagta tgaaatgcct tttaagagga tagaacccat tacacatgag caggctttag atgtcagtga gcaagggcct tttggggagc tgcagactgt ctcggccatt tccatggccg cggccacctc cacagctcta gccactgccc atccagatct ccgttctacc tttcacaaca cgtaccattc acaaatgcgt cagaaacact actaccgaag ctatgagtac gacgtacctc ctaccggcac cctgcctctt acctccatag gcaatcagca tacctactgt aacatcccta tgacactcat caacgggcag cggccacaga caaaatcgag cagggagcag aatccagatg aggcccacac aaacagtgcc atcctgccgc tgttgccaag ggagaccagt atatccagtg tgatatggtg a. It is sometimes possible for the material contained within the vial of "IL1RAPL1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
