Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

IL1RAP cdna clone

IL1RAP cDNA Clone

Gene Names
IL1RAP; IL1R3; C3orf13; IL-1RAcP
Synonyms
IL1RAP; IL1RAP cDNA Clone; IL1RAP cdna clone
Ordering
 
When autocomplete results are available use up and down arrows to review and enter to select. Touch device users, explore by touch or with swipe gestures.
For Research Use Only!
Sequence
atgacacttctgtggtgtgtagtgagtctctacttttatggaatcctgcaaagtgatgcctcagaacgctgcgatgactggggactagacaccatgaggcaaatccaagtgtttgaagatgagccagctcgcatcaagtgcccactctttgaacacttcttgaaattcaactacagcacagcccattcagctggccttactctgatctggtattggactaggcaggaccgggaccttgaggagccaattaacttccgcctccccgagaaccgcattagtaaggagaaagatgtgctgtggttccggcccactctcctcaatgacactggcaactatacctgcatgttaaggaacactacatattgcagcaaagttgcatttcccttggaagttgttcaaaaagacagctgtttcaattcccccatgaaactcccagtgcataaactgtatatagaatatggcattcagaggatcacttgtccaaatgtagatggatattttccttccagtgtcaaaccgactatcacttggtatatgggctgttataaaatacagaattttaataatgtaatacccgaaggtatgaacttgagtttcctcattgccttaatttcaaataatggaaattacacatgtgttgttacatatccagaaaatggacgtacgtttcatctcaccaggactctgactgtaaaggtagtaggctctccaaaaaatgcagtgccccctgtgatccattcacctaatgatcatgtggtctatgagaaagaaccaggagaggagctactcattccctgtacggtctattttagttttctgatggattctcgcaatgaggtttggtggaccattgatggaaaaaaacctgatgacatcactattgatgtcaccattaacgaaagtataagtcatagtagaacagaagatgaaacaagaactcagattttgagcatcaagaaagttacctctgaggatctcaagcgcagctatgtctgtcatgctagaagtgccaaaggcgaagttgccaaagcagccaaggtgaagcagaaaggtaatagatgcggtcagtga
Sequence Length
1071
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
78,603 Da
NCBI Official Full Name
Homo sapiens interleukin 1 receptor accessory protein, mRNA
NCBI Official Synonym Full Names
interleukin 1 receptor accessory protein
NCBI Official Symbol
IL1RAP
NCBI Official Synonym Symbols
IL1R3; C3orf13; IL-1RAcP
NCBI Protein Information
interleukin-1 receptor accessory protein
UniProt Protein Name
Interleukin-1 receptor accessory protein
UniProt Gene Name
IL1RAP
UniProt Synonym Gene Names
C3orf13; IL1R3; IL-1 receptor accessory protein; IL-1RAcP; IL-1R-3; IL-1R3
UniProt Entry Name
IL1AP_HUMAN

NCBI Description

Interleukin 1 induces synthesis of acute phase and proinflammatory proteins during infection, tissue damage, or stress, by forming a complex at the cell membrane with an interleukin 1 receptor and an accessory protein. This gene encodes the interleukin 1 receptor accessory protein. The protein is a necessary part of the interleukin 1 receptor complex which initiates signalling events that result in the activation of interleukin 1-responsive genes. Alternative splicing of this gene results in two transcript variants encoding two different isoforms, one membrane-bound and one soluble. The ratio of soluble to membrane-bound forms increases during acute-phase induction or stress. [provided by RefSeq, Nov 2009]

Uniprot Description

IL1RAP: Coreceptor with IL1R1. Associates with IL1R1 bound to IL1B to form the high affinity interleukin-1 receptor complex which mediates interleukin-1-dependent activation of NF-kappa-B and other pathways. Signaling involves the recruitment of adapter molecules such as TOLLIP, MYD88, and IRAK1 or IRAK2 via the respective TIR domains of the receptor/coreceptor subunits. Recruits TOLLIP to the signaling complex. Does not bind to interleukin-1 alone; binding of IL1RN to IL1R1, prevents its association with IL1R1 to form a signaling complex. The cellular response is modulated through a non-signaling association with the membrane IL1R2 decoy receptor. Secreted forms (isoforms 2 and 3) associate with secreted ligand-bound IL1R2 and increase the affinity of secreted IL1R2 for IL1B; this complex formation may be the dominant mechanism for neutralization of IL1B by secreted/soluble receptors. Belongs to the interleukin-1 receptor family. 4 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, integral; Receptor, misc.

Chromosomal Location of Human Ortholog: 3q28

Cellular Component: integral to plasma membrane; membrane; plasma membrane

Molecular Function: signal transducer activity

Biological Process: immune response; protein complex assembly

Research Articles on IL1RAP

Similar Products

Product Notes

The IL1RAP il1rap (Catalog #AAA1276360) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgacacttc tgtggtgtgt agtgagtctc tacttttatg gaatcctgca aagtgatgcc tcagaacgct gcgatgactg gggactagac accatgaggc aaatccaagt gtttgaagat gagccagctc gcatcaagtg cccactcttt gaacacttct tgaaattcaa ctacagcaca gcccattcag ctggccttac tctgatctgg tattggacta ggcaggaccg ggaccttgag gagccaatta acttccgcct ccccgagaac cgcattagta aggagaaaga tgtgctgtgg ttccggccca ctctcctcaa tgacactggc aactatacct gcatgttaag gaacactaca tattgcagca aagttgcatt tcccttggaa gttgttcaaa aagacagctg tttcaattcc cccatgaaac tcccagtgca taaactgtat atagaatatg gcattcagag gatcacttgt ccaaatgtag atggatattt tccttccagt gtcaaaccga ctatcacttg gtatatgggc tgttataaaa tacagaattt taataatgta atacccgaag gtatgaactt gagtttcctc attgccttaa tttcaaataa tggaaattac acatgtgttg ttacatatcc agaaaatgga cgtacgtttc atctcaccag gactctgact gtaaaggtag taggctctcc aaaaaatgca gtgccccctg tgatccattc acctaatgat catgtggtct atgagaaaga accaggagag gagctactca ttccctgtac ggtctatttt agttttctga tggattctcg caatgaggtt tggtggacca ttgatggaaa aaaacctgat gacatcacta ttgatgtcac cattaacgaa agtataagtc atagtagaac agaagatgaa acaagaactc agattttgag catcaagaaa gttacctctg aggatctcaa gcgcagctat gtctgtcatg ctagaagtgc caaaggcgaa gttgccaaag cagccaaggt gaagcagaaa ggtaatagat gcggtcagtg a. It is sometimes possible for the material contained within the vial of "IL1RAP, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.
Looking for a specific manual?
Request a Manual