Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

IL1R2 cdna clone

IL1R2 cDNA Clone

Gene Names
IL1R2; IL1RB; CD121b; IL1R2c; CDw121b; IL-1R-2; IL-1RT2; IL-1RT-2
Synonyms
IL1R2; IL1R2 cDNA Clone; IL1R2 cdna clone
Ordering
For Research Use Only!
Sequence
atgttgcgcttgtacgtgttggtaatgggagtttctgccttcacccttcagcctgcggcacacacaggggctgccagaagctgccggtttcgtgggaggcattacaagcgggagttcaggctggaaggggagcctgtagccctgaggtgcccccaggtgccctactggttgtgggcctctgtcagcccccgcatcaacctgacatggcataaaaatgactctgctaggacggtcccaggagaagaagagacacggatgtgggcccaggacggtgctctgtggcttctgccagccttgcaggaggactctggcacctacgtctgcactactagaaatgcttcttactgtgacaaaatgtccattgagctcagagtttttgagaatacagatgctttcctgccgttcatctcatacccgcaaattttaaccttgtcaacctctggggtattagtatgccctgacctgagtgaattcacccgtgacaaaactgacgtgaagattcaatggtacaaggattctcttcttttggataaagacaatgagaaatttctaagtgtgagggggaccactcacttactcgtacacgatgtggccctggaagatgctggctattaccgctgtgtcctgacatttgcccatgaaggccagcaatacaacatcactaggagtattgagctacgcatcaagaaaaaaaaagaagagaccattcctgtgatcatttcccccctcaagaccatatcagcttctctggggtcaagactgacaatcccgtgtaaggtgtttctgggaaccggcacacccttaaccaccatgctgtggtggacggccaatgacacccacatagagagcgcctacccgggaggccgcgtgaccgaggggccacgccaggaatattcagaaaataatgagaactacattgaagtgccattgatttttgatcctgtcacaagagaggatttgcacatggattttaaatgtgttgtccataataccctgagttttcagacactacgcaccacagtcaaggaagcctcctccacgttctcctggggcattgtgctggccccactttcactggccttcttggttttggggggaatatggatgcacagacggtgcaaacacagaactggaaaagcagatggtctgactgtgctatggcctcatcatcaagactttcaatcctatcccaagtga
Sequence Length
1197
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
33,622 Da
NCBI Official Full Name
Homo sapiens interleukin 1 receptor, type II, mRNA
NCBI Official Synonym Full Names
interleukin 1 receptor type 2
NCBI Official Symbol
IL1R2
NCBI Official Synonym Symbols
IL1RB; CD121b; IL1R2c; CDw121b; IL-1R-2; IL-1RT2; IL-1RT-2
NCBI Protein Information
interleukin-1 receptor type 2
UniProt Protein Name
Interleukin-1 receptor type 2
Protein Family
UniProt Gene Name
IL1R2
UniProt Synonym Gene Names
IL1RB; IL-1R-2; IL-1RT-2; IL-1RT2; IL-1R-beta; mIL-1R2; mIL-1RII; sIL-1R2; sIL-1RII
UniProt Entry Name
IL1R2_HUMAN

NCBI Description

The protein encoded by this gene is a cytokine receptor that belongs to the interleukin 1 receptor family. This protein binds interleukin alpha (IL1A), interleukin beta (IL1B), and interleukin 1 receptor, type I(IL1R1/IL1RA), and acts as a decoy receptor that inhibits the activity of its ligands. Interleukin 4 (IL4) is reported to antagonize the activity of interleukin 1 by inducing the expression and release of this cytokine. This gene and three other genes form a cytokine receptor gene cluster on chromosome 2q12. Alternative splicing results in multiple transcript variants and protein isoforms. Alternative splicing produces both membrane-bound and soluble proteins. A soluble protein is also produced by proteolytic cleavage. [provided by RefSeq, May 2012]

Uniprot Description

IL-1RB: Non-signaling receptor for IL1A, IL1B and IL1RN. Reduces IL1B activities. Serves as a decoy receptor by competetive binding to IL1B and preventing its binding to IL1R1. Also modulates cellular response through non-signaling association with IL1RAP after binding to IL1B. IL1R2 (membrane and secreted forms) preferentially binds IL1B and poorly IL1A and IL1RN. The secreted IL1R2 recruits secreted IL1RAP with high affinity; this complex formation may be the dominant mechanism for neutralization of IL1B by secreted/soluble receptors. Belongs to the interleukin-1 receptor family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, integral

Chromosomal Location of Human Ortholog: 2q12

Cellular Component: plasma membrane

Molecular Function: interleukin-1 receptor activity; protein binding

Biological Process: immune response

Research Articles on IL1R2

Similar Products

Product Notes

The IL1R2 il1r2 (Catalog #AAA1276084) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgttgcgct tgtacgtgtt ggtaatggga gtttctgcct tcacccttca gcctgcggca cacacagggg ctgccagaag ctgccggttt cgtgggaggc attacaagcg ggagttcagg ctggaagggg agcctgtagc cctgaggtgc ccccaggtgc cctactggtt gtgggcctct gtcagccccc gcatcaacct gacatggcat aaaaatgact ctgctaggac ggtcccagga gaagaagaga cacggatgtg ggcccaggac ggtgctctgt ggcttctgcc agccttgcag gaggactctg gcacctacgt ctgcactact agaaatgctt cttactgtga caaaatgtcc attgagctca gagtttttga gaatacagat gctttcctgc cgttcatctc atacccgcaa attttaacct tgtcaacctc tggggtatta gtatgccctg acctgagtga attcacccgt gacaaaactg acgtgaagat tcaatggtac aaggattctc ttcttttgga taaagacaat gagaaatttc taagtgtgag ggggaccact cacttactcg tacacgatgt ggccctggaa gatgctggct attaccgctg tgtcctgaca tttgcccatg aaggccagca atacaacatc actaggagta ttgagctacg catcaagaaa aaaaaagaag agaccattcc tgtgatcatt tcccccctca agaccatatc agcttctctg gggtcaagac tgacaatccc gtgtaaggtg tttctgggaa ccggcacacc cttaaccacc atgctgtggt ggacggccaa tgacacccac atagagagcg cctacccggg aggccgcgtg accgaggggc cacgccagga atattcagaa aataatgaga actacattga agtgccattg atttttgatc ctgtcacaag agaggatttg cacatggatt ttaaatgtgt tgtccataat accctgagtt ttcagacact acgcaccaca gtcaaggaag cctcctccac gttctcctgg ggcattgtgc tggccccact ttcactggcc ttcttggttt tggggggaat atggatgcac agacggtgca aacacagaac tggaaaagca gatggtctga ctgtgctatg gcctcatcat caagactttc aatcctatcc caagtga. It is sometimes possible for the material contained within the vial of "IL1R2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.