Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

IL18 cdna clone

IL18 cDNA Clone

Gene Names
IL18; IGIF; IL-18; IL-1g; IL1F4
Synonyms
IL18; IL18 cDNA Clone; IL18 cdna clone
Ordering
For Research Use Only!
Sequence
atggctgctgaaccagtagaagacaattgcatcaactttgtggcaatgaaatttattgacaatacgctttactttatagctgaagatgatgaaaacctggaatccgattactttggcaagcttgaatctaaattatcagtcataagaaatttgaatgaccaagttctcttcattgaccaaggaaatcggcctctatttgaagatatgactgattctgactgtagagataatgcaccccggaccatatttattataagtatgtataaagatagccagcctagaggtatggctgtaactatctctgtgaagtgtgagaaaatttcaactctctcctgtgagaacaaaattatttcctttaaggaaatgaatcctcctgataacatcaaggatacaaaaagtgacatcatattctttcagagaagtgtcccaggacatgataataagatgcaatttgaatcttcatcatacgaaggatactttctagcttgtgaaaaagagagagacctttttaaactcattttgaaaaaagaggatgaattgggggatagatctataatgttcactgttcaaaacgaagactag
Sequence Length
582
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
21,896 Da
NCBI Official Full Name
Homo sapiens interleukin 18 (interferon-gamma-inducing factor), mRNA
NCBI Official Synonym Full Names
interleukin 18
NCBI Official Symbol
IL18
NCBI Official Synonym Symbols
IGIF; IL-18; IL-1g; IL1F4
NCBI Protein Information
interleukin-18
UniProt Protein Name
Interleukin-18
Protein Family
UniProt Gene Name
IL18
UniProt Synonym Gene Names
IGIF; IL1F4; IL-18; IFN-gamma-inducing factor; IL-1 gamma
UniProt Entry Name
IL18_HUMAN

NCBI Description

The protein encoded by this gene is a proinflammatory cytokine that augments natural killer cell activity in spleen cells, and stimulates interferon gamma production in T-helper type I cells. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Aug 2011]

Uniprot Description

IL18: Augments natural killer cell activity in spleen cells and stimulates interferon gamma production in T-helper type I cells. Belongs to the IL-1 family.

Protein type: Cytokine

Chromosomal Location of Human Ortholog: 11q22.2-q22.3

Cellular Component: cytosol; extracellular region; extracellular space

Molecular Function: cytokine activity; protein binding

Biological Process: angiogenesis; cell-cell signaling; chemokine biosynthetic process; granulocyte macrophage colony-stimulating factor biosynthetic process; immune response; inflammatory response; interferon-gamma biosynthetic process; interleukin-13 biosynthetic process; interleukin-2 biosynthetic process; lipopolysaccharide-mediated signaling pathway; MAPKKK cascade; positive regulation of activated T cell proliferation; positive regulation of granulocyte macrophage colony-stimulating factor production; positive regulation of inflammatory response; positive regulation of interferon-gamma production; positive regulation of interleukin-17 production; positive regulation of natural killer cell proliferation; positive regulation of NK T cell proliferation; positive regulation of tissue remodeling; positive regulation of tyrosine phosphorylation of Stat3 protein; regulation of cell adhesion; sleep; T-helper 1 type immune response; T-helper 2 type immune response

Research Articles on IL18

Similar Products

Product Notes

The IL18 il18 (Catalog #AAA1276453) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctgctg aaccagtaga agacaattgc atcaactttg tggcaatgaa atttattgac aatacgcttt actttatagc tgaagatgat gaaaacctgg aatccgatta ctttggcaag cttgaatcta aattatcagt cataagaaat ttgaatgacc aagttctctt cattgaccaa ggaaatcggc ctctatttga agatatgact gattctgact gtagagataa tgcaccccgg accatattta ttataagtat gtataaagat agccagccta gaggtatggc tgtaactatc tctgtgaagt gtgagaaaat ttcaactctc tcctgtgaga acaaaattat ttcctttaag gaaatgaatc ctcctgataa catcaaggat acaaaaagtg acatcatatt ctttcagaga agtgtcccag gacatgataa taagatgcaa tttgaatctt catcatacga aggatacttt ctagcttgtg aaaaagagag agaccttttt aaactcattt tgaaaaaaga ggatgaattg ggggatagat ctataatgtt cactgttcaa aacgaagact ag. It is sometimes possible for the material contained within the vial of "IL18, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.