Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

IL16 cdna clone

IL16 cDNA Clone

Gene Names
IL16; LCF; NIL16; PRIL16; prIL-16
Synonyms
IL16; IL16 cDNA Clone; IL16 cdna clone
Ordering
For Research Use Only!
Sequence
atggagtcgcacagccgcgctggaaagagcagaaaatctgcaaaatttcggtccatctccaggtccctgatgctctgtaatgctaagaccagtgatgatggctctagccctgatgagaaatatcctgatccctttgagatttccttggcccagggcaaggagggaattttccactcatctgtgcagctggcagacacatcggaggctgggcccagcagtgttcctgatctagcactggcctcggaggctgctcaactccaagcagctgggaatgatcgaggcaagacctgtaggaggatattcttcatgaaggaatcttccacagcttcctctcgagaaaagcctggaaaactagaagcacaaagtagtaacttcctgtttcctaaagcctgccaccaaagggcacgcagcaactcaaccagtgttaatccctattgcacaagagaaattgattttccaatgaccaagaaatctgcagcgcccacggacaggcagccttactctctctgcagtaacaggaagtccctctctcaacaattggactgtccagcaggaaaggctgcgggaacttcgagaccaacacggtccctgagcacagctcagctcgtgcagccatctgggggcctccaggcttcagtcatctccaacatcgtgctgatgaagggccaggctaagggtctgggcttcagcatcgttgggggaaaagacagcatttatggccccattgggatttacgtcaaaaccatttttgcagggggagcagcagcagccgatggaaggctacaggaaggtgatgaaattctggagctcaatggtgaatcaatggctggactaacacatcaggatgctttgcagaagttcaagcaagccaaaaaggggctcctcaccctcaccgtgagaacccgcctgacggcgcctccttccctgtgcagccacctgtctcccccactgtgccgctccctgagctccagcacttgtatcaccaaggacagcagctccttcgccttggaaagcccctcggctcccatcagcaccgccaagcccaattacagaatcatggtggaggtttctctgcagaaagaggccggcgtgggcctgggcatcggcctgtgcagcgttccctacttccaatgcatctctggcattttcgtccacacgctgtcaccaggatccgtggcgcacctggacggacgtctccggtgtggggacgagattgtggaaatcagtgattcccctgtgcactgcctgacgctcaatgaagtctacacgatcctgagtcactgtgatcccggtccagtctccatcattgttagccgacatccagacccacagaaggaagaaatggaggctcaggaggttaagtaa
Sequence Length
1365
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
59,345 Da
NCBI Official Full Name
Homo sapiens interleukin 16 (lymphocyte chemoattractant factor), mRNA
NCBI Official Synonym Full Names
interleukin 16
NCBI Official Symbol
IL16
NCBI Official Synonym Symbols
LCF; NIL16; PRIL16; prIL-16
NCBI Protein Information
pro-interleukin-16
UniProt Protein Name
Pro-interleukin-16
Protein Family
UniProt Gene Name
IL16
UniProt Synonym Gene Names
IL-16; LCF
UniProt Entry Name
IL16_HUMAN

NCBI Description

The protein encoded by this gene is a pleiotropic cytokine that functions as a chemoattractant, a modulator of T cell activation, and an inhibitor of HIV replication. The signaling process of this cytokine is mediated by CD4. The product of this gene undergoes proteolytic processing, which is found to yield two functional proteins. The cytokine function is exclusively attributed to the secreted C-terminal peptide, while the N-terminal product may play a role in cell cycle control. Caspase 3 is reported to be involved in the proteolytic processing of this protein. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2010]

Uniprot Description

IL16: Interleukin-16 stimulates a migratory response in CD4+ lymphocytes, monocytes, and eosinophils. Primes CD4+ T-cells for IL-2 and IL-15 responsiveness. Also induces T-lymphocyte expression of interleukin 2 receptor. Ligand for CD4. 3 isoforms of the human protein are produced by alternative promoter.

Protein type: DNA-binding; Motility/polarity/chemotaxis; Cytokine

Chromosomal Location of Human Ortholog: 15q26.3

Cellular Component: cytoplasm; cytosol; extracellular region; nucleus; plasma membrane

Biological Process: immune response

Research Articles on IL16

Similar Products

Product Notes

The IL16 il16 (Catalog #AAA1271735) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagtcgc acagccgcgc tggaaagagc agaaaatctg caaaatttcg gtccatctcc aggtccctga tgctctgtaa tgctaagacc agtgatgatg gctctagccc tgatgagaaa tatcctgatc cctttgagat ttccttggcc cagggcaagg agggaatttt ccactcatct gtgcagctgg cagacacatc ggaggctggg cccagcagtg ttcctgatct agcactggcc tcggaggctg ctcaactcca agcagctggg aatgatcgag gcaagacctg taggaggata ttcttcatga aggaatcttc cacagcttcc tctcgagaaa agcctggaaa actagaagca caaagtagta acttcctgtt tcctaaagcc tgccaccaaa gggcacgcag caactcaacc agtgttaatc cctattgcac aagagaaatt gattttccaa tgaccaagaa atctgcagcg cccacggaca ggcagcctta ctctctctgc agtaacagga agtccctctc tcaacaattg gactgtccag caggaaaggc tgcgggaact tcgagaccaa cacggtccct gagcacagct cagctcgtgc agccatctgg gggcctccag gcttcagtca tctccaacat cgtgctgatg aagggccagg ctaagggtct gggcttcagc atcgttgggg gaaaagacag catttatggc cccattggga tttacgtcaa aaccattttt gcagggggag cagcagcagc cgatggaagg ctacaggaag gtgatgaaat tctggagctc aatggtgaat caatggctgg actaacacat caggatgctt tgcagaagtt caagcaagcc aaaaaggggc tcctcaccct caccgtgaga acccgcctga cggcgcctcc ttccctgtgc agccacctgt ctcccccact gtgccgctcc ctgagctcca gcacttgtat caccaaggac agcagctcct tcgccttgga aagcccctcg gctcccatca gcaccgccaa gcccaattac agaatcatgg tggaggtttc tctgcagaaa gaggccggcg tgggcctggg catcggcctg tgcagcgttc cctacttcca atgcatctct ggcattttcg tccacacgct gtcaccagga tccgtggcgc acctggacgg acgtctccgg tgtggggacg agattgtgga aatcagtgat tcccctgtgc actgcctgac gctcaatgaa gtctacacga tcctgagtca ctgtgatccc ggtccagtct ccatcattgt tagccgacat ccagacccac agaaggaaga aatggaggct caggaggtta agtaa. It is sometimes possible for the material contained within the vial of "IL16, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.