Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

IKZF1 cdna clone

IKZF1 cDNA Clone

Gene Names
IKZF1; IK1; LYF1; LyF-1; CVID13; IKAROS; PPP1R92; PRO0758; ZNFN1A1; Hs.54452
Synonyms
IKZF1; IKZF1 cDNA Clone; IKZF1 cdna clone
Ordering
For Research Use Only!
Sequence
atggatgctgatgagggtcaagacatgtcccaagtttcagggaaggaaagcccccctgtaagcgatactccagatgagggcgatgagcccatgccgatccccgaggacctctccaccacctcgggaggacagcaaagctccaagagtgacagagtcgtggccagtaatgttaaagtagagactcagagtgatgaagagaatgggcgtgcctgtgaaatgaatggggaagaatgtgcggaggatttacgaatgcttgatgcctcgggagagaaaatgaatggctcccacagggaccaaggcagctcggctttgtcgggagttggaggcattcgacttcctaacggaaaactaaagtgtgatatctgtgggatcatttgcatcgggcccaatgtgctcatggttcacaaaagaagccacactggagaacggcccttccagtgcaatcagtgcggggcctcattcacccagaagggcaacctgctccggcacatcaagctgcattccggggagaagcccttcaaatgccacctctgcaactacgcctgccgccggagggacgccctcactggccacctgaggacgcactccgtcattaaagaagaaactaatcacagtgaaatggcagaagacctgtgcaagataggatcagagagatctctcgtgctggacagactagcaagtaacgtcgccaaacgtaagagctctatgcctcagaaatttcttggggacaagggcctgtccgacacgccctacgacagcagcgccagctacgagaaggagaacgaaatgatgaagtcccacgtgatggaccaagccatcaacaacgccatcaactacctgggggccgagtccctgcgcccgctggtgcagacgcccccgggcggttccgaggtggtcccggtcatcagcccgatgtaccagctgcacaagccgctcgcggagggcaccccgcgctccaaccactcggcccaggacagcgccgtggagaacctgctgctgctctccaaggccaagttggtgccctcggagcgcgaggcgtccccgagcaacagctgccaagactccacggacaccgagagcaacaacgaggagcagcgcagcggtctcatctacctgaccaaccacatcgccccgcacgcgcgcaacgggctgtcgctcaaggaggagcaccgcgcctacgacctgctgcgcgccgcctccgagaactcgcaggacgcgctccgcgtggtcagcaccagcggggagcagatgaaggtgtacaagtgcgaacactgccgggtgctcttcctggatcacgtcatgtacaccatccacatgggctgccacggcttccgtgatccttttgagtgcaacatgtgcggctaccacagccaggaccggtacgagttctcgtcgcacataacgcgaggggagcaccgcttccacatgagctaa
Sequence Length
1434
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
24,470 Da
NCBI Official Full Name
Homo sapiens IKAROS family zinc finger 1 (Ikaros), mRNA
NCBI Official Synonym Full Names
IKAROS family zinc finger 1
NCBI Official Symbol
IKZF1
NCBI Official Synonym Symbols
IK1; LYF1; LyF-1; CVID13; IKAROS; PPP1R92; PRO0758; ZNFN1A1; Hs.54452
NCBI Protein Information
DNA-binding protein Ikaros
UniProt Protein Name
DNA-binding protein Ikaros
Protein Family
UniProt Gene Name
IKZF1
UniProt Synonym Gene Names
IK1; IKAROS; LYF1; ZNFN1A1
UniProt Entry Name
IKZF1_HUMAN

NCBI Description

This gene encodes a transcription factor that belongs to the family of zinc-finger DNA-binding proteins associated with chromatin remodeling. The expression of this protein is restricted to the fetal and adult hemo-lymphopoietic system, and it functions as a regulator of lymphocyte differentiation. Several alternatively spliced transcript variants encoding different isoforms have been described for this gene. Most isoforms share a common C-terminal domain, which contains two zinc finger motifs that are required for hetero- or homo-dimerization, and for interactions with other proteins. The isoforms, however, differ in the number of N-terminal zinc finger motifs that bind DNA and in nuclear localization signal presence, resulting in members with and without DNA-binding properties. Only a few isoforms contain the requisite three or more N-terminal zinc motifs that confer high affinity binding to a specific core DNA sequence element in the promoters of target genes. The non-DNA-binding isoforms are largely found in the cytoplasm, and are thought to function as dominant-negative factors. Overexpression of some dominant-negative isoforms have been associated with B-cell malignancies, such as acute lymphoblastic leukemia (ALL). [provided by RefSeq, May 2014]

Uniprot Description

Ikaros: a transcription factor of the ikaros C2H2-type zinc-finger protein family. Binds and activates the enhancer (delta-A element) of the CD3-delta gene. Functions in the specification and the maturation of the T-lymphocyte. Also interacts with a critical control element in the TDT (terminal deoxynucleotidyltransferase) promoter as well as with the promoters for other genes expressed during early stages of B- and T-cell development. Deletions in Ikaros have been observed in a subset of pre-B-cell acute lymphoblastic leukemia (B-ALL) cases. Seven alternatively spliced human isoforms have been described.

Protein type: C2H2-type zinc finger protein; DNA-binding; Transcription factor

Chromosomal Location of Human Ortholog: 7p12.2

Cellular Component: nucleus; protein complex

Molecular Function: DNA binding; protein binding; transcription factor activity

Biological Process: erythrocyte differentiation; lymphocyte differentiation; mesoderm development; negative regulation of transcription from RNA polymerase II promoter; negative regulation of transcription, DNA-dependent; positive regulation of transcription from RNA polymerase II promoter

Disease: Immunodeficiency, Common Variable, 13

Research Articles on IKZF1

Similar Products

Product Notes

The IKZF1 ikzf1 (Catalog #AAA1265813) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggatgctg atgagggtca agacatgtcc caagtttcag ggaaggaaag cccccctgta agcgatactc cagatgaggg cgatgagccc atgccgatcc ccgaggacct ctccaccacc tcgggaggac agcaaagctc caagagtgac agagtcgtgg ccagtaatgt taaagtagag actcagagtg atgaagagaa tgggcgtgcc tgtgaaatga atggggaaga atgtgcggag gatttacgaa tgcttgatgc ctcgggagag aaaatgaatg gctcccacag ggaccaaggc agctcggctt tgtcgggagt tggaggcatt cgacttccta acggaaaact aaagtgtgat atctgtggga tcatttgcat cgggcccaat gtgctcatgg ttcacaaaag aagccacact ggagaacggc ccttccagtg caatcagtgc ggggcctcat tcacccagaa gggcaacctg ctccggcaca tcaagctgca ttccggggag aagcccttca aatgccacct ctgcaactac gcctgccgcc ggagggacgc cctcactggc cacctgagga cgcactccgt cattaaagaa gaaactaatc acagtgaaat ggcagaagac ctgtgcaaga taggatcaga gagatctctc gtgctggaca gactagcaag taacgtcgcc aaacgtaaga gctctatgcc tcagaaattt cttggggaca agggcctgtc cgacacgccc tacgacagca gcgccagcta cgagaaggag aacgaaatga tgaagtccca cgtgatggac caagccatca acaacgccat caactacctg ggggccgagt ccctgcgccc gctggtgcag acgcccccgg gcggttccga ggtggtcccg gtcatcagcc cgatgtacca gctgcacaag ccgctcgcgg agggcacccc gcgctccaac cactcggccc aggacagcgc cgtggagaac ctgctgctgc tctccaaggc caagttggtg ccctcggagc gcgaggcgtc cccgagcaac agctgccaag actccacgga caccgagagc aacaacgagg agcagcgcag cggtctcatc tacctgacca accacatcgc cccgcacgcg cgcaacgggc tgtcgctcaa ggaggagcac cgcgcctacg acctgctgcg cgccgcctcc gagaactcgc aggacgcgct ccgcgtggtc agcaccagcg gggagcagat gaaggtgtac aagtgcgaac actgccgggt gctcttcctg gatcacgtca tgtacaccat ccacatgggc tgccacggct tccgtgatcc ttttgagtgc aacatgtgcg gctaccacag ccaggaccgg tacgagttct cgtcgcacat aacgcgaggg gagcaccgct tccacatgag ctaa. It is sometimes possible for the material contained within the vial of "IKZF1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.