Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

IFIT5 cdna clone

IFIT5 cDNA Clone

Gene Names
IFIT5; P58; RI58; ISG58
Synonyms
IFIT5; IFIT5 cDNA Clone; IFIT5 cdna clone
Ordering
For Research Use Only!
Sequence
atgagtgaaattcgtaaggacaccttgaaggccattctgttggagttagaatgtcattttacatggaatttacttaaggaagacattgatctgtttgaggtagaagatacaattgggcaacagcttgaatttcttaccacaaaatctagacttgctctttataacctattggcctatgtgaaacacctaaaaggccaaaataaagacgcccttgagtgcttggaacaagcagaagaaataatccagcaagaacactcagacaaagaagaagtacgaagcctggtcacttggggaaactatgcctgggtgtattatcacatggaccagcttgaagaagctcagaagtatacaggtaagatagggaatgtctgtaagaaattgtccagtccttctaactacaagttggagtgtcctgagactgactgtgagaaaggctgggcactcttgaaatttggaggaaagtattatcaaaaggctaaagcggcttttgagaaggctctggaagtggagcctgacaatccagaatttaacatcggctatgctatcacagtgtatcggctggatgattctgatagagaagggtctgtaaagagcttttctctggggcctttgagaaaggctgttaccctgaacccagataacagctatattaaggtttttctggcactgaagcttcaagatgtacatgcagaagctgaaggggaaaagtatattgaagaaatcctggaccaaatatcatcccagccttacgtccttcgttatgcagccaagttctataggagaaaaaattcctggaacaaagctctcgaacttttaaaaaaggccttggaggtgacaccaacttcttctttcctgcatcaccagatgggactttgctacagggcacaaatgatccaaatcaagaaggccacacacaacagacctaaaggaaaggataaactaaaggttgatgagctgatttcatctgctatatttcatttcaaagcagccatggaacgagactctatgtttgcatttgcctacacagacctggccaacatgtatgctgaaggaggccagtatagcaatgctgaggacattttccggaaagctcttcgtctggagaacataaccgatgatcacaaacatcagatccattaccactatggccgctttcaggaatttcaccgtaaatcagaaaatactgccatccatcattatttagaagccttaaaggtcaaagacagatcaccccttcgcaccaaactgacaagtgctctgaagaaattgtctaccaagagactttgtcacaatgctttagatgtgcagagtttaagtgccctagggtttgtttacaagctggaaggagaaaagaggcaagctgctgagtactatgagaaggcacaaaagatagatccagaaaatgcagaattcctgactgctctctgtgagctccgactttccatttaa
Sequence Length
1449
Vector
pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
50,520 Da
NCBI Official Full Name
Homo sapiens interferon-induced protein with tetratricopeptide repeats 5, mRNA
NCBI Official Synonym Full Names
interferon induced protein with tetratricopeptide repeats 5
NCBI Official Symbol
IFIT5
NCBI Official Synonym Symbols
P58; RI58; ISG58
NCBI Protein Information
interferon-induced protein with tetratricopeptide repeats 5
UniProt Protein Name
Interferon-induced protein with tetratricopeptide repeats 5
UniProt Gene Name
IFIT5
UniProt Synonym Gene Names
ISG58; RI58; IFIT-5; P58
UniProt Entry Name
IFIT5_HUMAN

Uniprot Description

IFIT5: IFN-induced antiviral protein which acts as an inhibitor of cellular as well as viral processes, cell migration, proliferation, signaling, and viral replication. Belongs to the IFIT family.

Protein type: Unknown function

Chromosomal Location of Human Ortholog: 10q23.31

Cellular Component: actin cytoskeleton; apical part of cell; intracellular membrane-bound organelle; plasma membrane

Molecular Function: RNA binding; single-stranded RNA binding; tRNA binding

Biological Process: defense response to virus

Research Articles on IFIT5

Similar Products

Product Notes

The IFIT5 ifit5 (Catalog #AAA1272741) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagtgaaa ttcgtaagga caccttgaag gccattctgt tggagttaga atgtcatttt acatggaatt tacttaagga agacattgat ctgtttgagg tagaagatac aattgggcaa cagcttgaat ttcttaccac aaaatctaga cttgctcttt ataacctatt ggcctatgtg aaacacctaa aaggccaaaa taaagacgcc cttgagtgct tggaacaagc agaagaaata atccagcaag aacactcaga caaagaagaa gtacgaagcc tggtcacttg gggaaactat gcctgggtgt attatcacat ggaccagctt gaagaagctc agaagtatac aggtaagata gggaatgtct gtaagaaatt gtccagtcct tctaactaca agttggagtg tcctgagact gactgtgaga aaggctgggc actcttgaaa tttggaggaa agtattatca aaaggctaaa gcggcttttg agaaggctct ggaagtggag cctgacaatc cagaatttaa catcggctat gctatcacag tgtatcggct ggatgattct gatagagaag ggtctgtaaa gagcttttct ctggggcctt tgagaaaggc tgttaccctg aacccagata acagctatat taaggttttt ctggcactga agcttcaaga tgtacatgca gaagctgaag gggaaaagta tattgaagaa atcctggacc aaatatcatc ccagccttac gtccttcgtt atgcagccaa gttctatagg agaaaaaatt cctggaacaa agctctcgaa cttttaaaaa aggccttgga ggtgacacca acttcttctt tcctgcatca ccagatggga ctttgctaca gggcacaaat gatccaaatc aagaaggcca cacacaacag acctaaagga aaggataaac taaaggttga tgagctgatt tcatctgcta tatttcattt caaagcagcc atggaacgag actctatgtt tgcatttgcc tacacagacc tggccaacat gtatgctgaa ggaggccagt atagcaatgc tgaggacatt ttccggaaag ctcttcgtct ggagaacata accgatgatc acaaacatca gatccattac cactatggcc gctttcagga atttcaccgt aaatcagaaa atactgccat ccatcattat ttagaagcct taaaggtcaa agacagatca ccccttcgca ccaaactgac aagtgctctg aagaaattgt ctaccaagag actttgtcac aatgctttag atgtgcagag tttaagtgcc ctagggtttg tttacaagct ggaaggagaa aagaggcaag ctgctgagta ctatgagaag gcacaaaaga tagatccaga aaatgcagaa ttcctgactg ctctctgtga gctccgactt tccatttaa. It is sometimes possible for the material contained within the vial of "IFIT5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.